SGN Marker C2_At1g74640

SGN-M7051
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle309682 (SGN)
132513 (CGN)
---
Capsicum annuumSingleSGN-U201629---
Lycopersicon CombinedSingleSGN-U221108---
Solanum tuberosumSingleSGN-U254562---
ArabidopsisSingleAt1g74640 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 25464)
Chromosome
1
Position
28.04 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41163
Forward primer (5'-3')
ACCTAAGCTTGATTACAATGCTGATG
Accessions and product sizes
Solanum pennellii TA56
2500
Solanum lycopersicum TA209
2400
Approximate temperature
55°C
Reverse primer (5'-3')
TGCTAAGGTAGCAGCATGTCCTCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 10419
Forward primer (5'-3')
ACCTAAGCTTGATTACAATGCTGATG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TGCTAAGGTAGCAGCATGTCCTCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 2500
Approximate temperature
55°C
  
PCR data   Exp. ID 10420
Forward primer (5'-3')
ACCTAAGCTTGATTACAATGCTGATG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TGCTAAGGTAGCAGCATGTCCTCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 2400
Approximate temperature
55°C
  
PCR data   Exp. ID 10421
Forward primer (5'-3')
ACCTAAGCTTGATTACAATGCTGATG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TGCTAAGGTAGCAGCATGTCCTCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 2400
Approximate temperature
55°C
  
PCR data   Exp. ID 12807
Forward primer (5'-3')
ACCTAAGCTTGATTACAATGCTGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTAAGGTAGCAGCATGTCCTCC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 2400
Approximate temperature
55°C
  
PCR data   Exp. ID 12808
Forward primer (5'-3')
ACCTAAGCTTGATTACAATGCTGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTAAGGTAGCAGCATGTCCTCC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 2600
Approximate temperature
55°C
  
PCR data   Exp. ID 12809
Forward primer (5'-3')
ACCTAAGCTTGATTACAATGCTGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTAAGGTAGCAGCATGTCCTCC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 2500
Approximate temperature
55°C
  
PCR data   Exp. ID 12810
Forward primer (5'-3')
ACCTAAGCTTGATTACAATGCTGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTAAGGTAGCAGCATGTCCTCC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 12811
Forward primer (5'-3')
ACCTAAGCTTGATTACAATGCTGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTAAGGTAGCAGCATGTCCTCC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 12812
Forward primer (5'-3')
ACCTAAGCTTGATTACAATGCTGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTAAGGTAGCAGCATGTCCTCC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 32608
Forward primer (5'-3')
ACCTAAGCTTGATTACAATGCTGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTAAGGTAGCAGCATGTCCTCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 2400
Approximate temperature
55°C
  
PCR data   Exp. ID 32846
Forward primer (5'-3')
ACCTAAGCTTGATTACAATGCTGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTAAGGTAGCAGCATGTCCTCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 2400
Approximate temperature
55°C
  
PCR data   Exp. ID 32847
Forward primer (5'-3')
ACCTAAGCTTGATTACAATGCTGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTAAGGTAGCAGCATGTCCTCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 2500
Approximate temperature
55°C
  
PCR data   Exp. ID 32848
Forward primer (5'-3')
ACCTAAGCTTGATTACAATGCTGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTAAGGTAGCAGCATGTCCTCC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1300
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At1g74640  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7051 marker 7051
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)