SGN Marker C2_At1g75350

SGN-M7057
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U205003---
Lycopersicon CombinedSingleSGN-U217851---
Solanum tuberosumSingleSGN-U252156---
ArabidopsisSingleAt1g75350 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41353)
Chromosome
4
Position
140.60 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43329
Forward primer (5'-3')
AATGTCGCTCCTCCTTCATTCTCC
Accessions and product sizes
Approximate temperature
60°C
Reverse primer (5'-3')
ATGTATATCCTTCTTCCTGCAGCTCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38263)
Chromosome
4
Position
120.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39533
Forward primer (5'-3')
AATGTCGCTCCTCCTTCATTCTCC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ATGTATATCCTTCTTCCTGCAGCTCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25471)
Chromosome
1
Position
28.28 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10429
Forward primer (5'-3')
AATGTCGCTCCTCCTTCATTCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGTATATCCTTCTTCCTGCAGCTCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 10430
Forward primer (5'-3')
AATGTCGCTCCTCCTTCATTCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGTATATCCTTCTTCCTGCAGCTCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 10431
Forward primer (5'-3')
AATGTCGCTCCTCCTTCATTCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGTATATCCTTCTTCCTGCAGCTCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 12827
Forward primer (5'-3')
AATGTCGCTCCTCCTTCATTCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGTATATCCTTCTTCCTGCAGCTCC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 12828
Forward primer (5'-3')
AATGTCGCTCCTCCTTCATTCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGTATATCCTTCTTCCTGCAGCTCC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 12829
Forward primer (5'-3')
AATGTCGCTCCTCCTTCATTCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGTATATCCTTCTTCCTGCAGCTCC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 12830
Forward primer (5'-3')
AATGTCGCTCCTCCTTCATTCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGTATATCCTTCTTCCTGCAGCTCC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 12831
Forward primer (5'-3')
AATGTCGCTCCTCCTTCATTCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGTATATCCTTCTTCCTGCAGCTCC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 32609
Forward primer (5'-3')
AATGTCGCTCCTCCTTCATTCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGTATATCCTTCTTCCTGCAGCTCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 32853
Forward primer (5'-3')
AATGTCGCTCCTCCTTCATTCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGTATATCCTTCTTCCTGCAGCTCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 32854
Forward primer (5'-3')
AATGTCGCTCCTCCTTCATTCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGTATATCCTTCTTCCTGCAGCTCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 32855
Forward primer (5'-3')
AATGTCGCTCCTCCTTCATTCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGTATATCCTTCTTCCTGCAGCTCC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 10432
Forward primer (5'-3')
AATGTCGCTCCTCCTTCATTCTCC
Digested band sizes (using DraI)
Solanum pennellii LA716: 100
Solanum lycopersicum LA925: 150
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGTATATCCTTCTTCCTGCAGCTCC
Enzymes
All possible enzymes for pennellii and and lycopersicum: MspI, DraI, EcoRV, HaeIII
  
Accessions and product sizes
Solanum pennellii LA716: 150
Solanum lycopersicum LA925: 150
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At1g75350  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7057 marker 7057
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)