SGN Marker C2_At1g75510

SGN-M7059
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302389 (SGN)
119469 (CGN)
---
Capsicum annuumSingleSGN-U202806---
Lycopersicon CombinedSingleSGN-U220917---
Solanum tuberosumSingleSGN-U246957---
ArabidopsisSingleAt1g75510 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 25473)
Chromosome
1
Position
28.35 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41167
Forward primer (5'-3')
AAGCCGCAGCTTCATCTTCCTC
Accessions and product sizes
Solanum pennellii TA56
1000
Solanum lycopersicum TA209
1000
Approximate temperature
50°C
Reverse primer (5'-3')
TTCCAGTTCCACCCATCTCCATAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 10433
Forward primer (5'-3')
AAGCCGCAGCTTCATCTTCCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCAGTTCCACCCATCTCCATAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1000
Approximate temperature
50°C
  
PCR data   Exp. ID 10434
Forward primer (5'-3')
AAGCCGCAGCTTCATCTTCCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCAGTTCCACCCATCTCCATAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1000
Approximate temperature
50°C
  
PCR data   Exp. ID 32227
Forward primer (5'-3')
AAGCCGCAGCTTCATCTTCCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCAGTTCCACCCATCTCCATAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1000
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At1g75510  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7059 marker 7059
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)