SGN Marker C2_At1g76080

SGN-M7064
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300056 (SGN)
119972 (CGN)
---
Capsicum annuumSingleSGN-U204073---
Lycopersicon CombinedSingleSGN-U214628---
Solanum tuberosumSingleSGN-U244213---
ArabidopsisSingleAt1g76080 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41354)
Chromosome
4
Position
158.60 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43330
Forward primer (5'-3')
TAGTATGGAGGAATTGGATGAAGC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TCTTCTCTGCTGTGGAGCTGCAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38264)
Chromosome
4
Position
137.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39534
Forward primer (5'-3')
TAGTATGGAGGAATTGGATGAAGC
Accessions and product sizes
Solanum lycopersicum TA209
1350
Solanum pennellii TA56
1350
Approximate temperature
50°C
Reverse primer (5'-3')
TCTTCTCTGCTGTGGAGCTGCAC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
350+650
Solanum pennellii TA56
350+410
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25478)
Chromosome
1
Position
28.55 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10438
Forward primer (5'-3')
TAGTATGGAGGAATTGGATGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTTCTCTGCTGTGGAGCTGCAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1350
Approximate temperature
50°C
  
PCR data   Exp. ID 10439
Forward primer (5'-3')
TAGTATGGAGGAATTGGATGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTTCTCTGCTGTGGAGCTGCAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1350
Approximate temperature
50°C
  
PCR data   Exp. ID 10440
Forward primer (5'-3')
TAGTATGGAGGAATTGGATGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTTCTCTGCTGTGGAGCTGCAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1350
Approximate temperature
50°C
  
PCR data   Exp. ID 12832
Forward primer (5'-3')
TAGTATGGAGGAATTGGATGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTTCTCTGCTGTGGAGCTGCAC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12833
Forward primer (5'-3')
TAGTATGGAGGAATTGGATGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTTCTCTGCTGTGGAGCTGCAC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 32610
Forward primer (5'-3')
TAGTATGGAGGAATTGGATGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTTCTCTGCTGTGGAGCTGCAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 32856
Forward primer (5'-3')
TAGTATGGAGGAATTGGATGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTTCTCTGCTGTGGAGCTGCAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 32857
Forward primer (5'-3')
TAGTATGGAGGAATTGGATGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTTCTCTGCTGTGGAGCTGCAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 10441
Forward primer (5'-3')
TAGTATGGAGGAATTGGATGAAGC
Digested band sizes (using HinfI)
Solanum pennellii LA716: 350+410
Solanum lycopersicum LA925: 350+650
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTTCTCTGCTGTGGAGCTGCAC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI, RsaI, DraI, HinfI
All possible enzymes for lycopersicum and pimpinellifolium: AluI, RsaI
  
Accessions and product sizes
Solanum pennellii LA716: 1350
Solanum lycopersicum LA925: 1350
Approximate temperature
50°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At1g76080  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7064 marker 7064
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)