SGN Marker C2_At1g77250

SGN-M7083
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302346 (SGN)
122868 (CGN)
---
Lycopersicon CombinedSingleSGN-U236264---
Solanum tuberosumSingleSGN-U254541---
ArabidopsisSingleAt1g77250 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49223)
Chromosome
4
Position
54.44 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47154)
Chromosome
4
Position
51.10 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46614)
Chromosome
4
Position
48.80 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Pepper-COSII   
Map version
58 (location: 41356)
Chromosome
4
Position
70.10 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43332
Forward primer (5'-3')
AGCCGTCACAAAGTACGATTTTGTCATC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AATCAAAGAAAGTCCCATAAGAAGTTGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38267)
Chromosome
4
Position
66.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39537
Forward primer (5'-3')
AGCCGTCACAAAGTACGATTTTGTCATC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
AATCAAAGAAAGTCCCATAAGAAGTTGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25497)
Chromosome
1
Position
29.03 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g77250  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7083 marker 7083
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)