SGN Marker C2_At1g77290

SGN-M7084
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle310741 (SGN)
130636 (CGN)
---
Capsicum annuumSingleSGN-U204023---
Lycopersicon CombinedSingleSGN-U226038---
Solanum tuberosumSingleSGN-U258319---
ArabidopsisSingleAt1g77290 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 25498)
Chromosome
1
Position
29.04 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41175
Forward primer (5'-3')
AAGAACATGGATGCATTTTTCTTC
Accessions and product sizes
Solanum pennellii TA56
2000
Solanum lycopersicum TA209
450
Approximate temperature
55°C
Reverse primer (5'-3')
AGCCATTCGGGCAATTATTACACG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 10449
Forward primer (5'-3')
AAGAACATGGATGCATTTTTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCATTCGGGCAATTATTACACG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 2000
Approximate temperature
55°C
  
PCR data   Exp. ID 10450
Forward primer (5'-3')
AAGAACATGGATGCATTTTTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCATTCGGGCAATTATTACACG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 10451
Forward primer (5'-3')
AAGAACATGGATGCATTTTTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCATTCGGGCAATTATTACACG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 12844
Forward primer (5'-3')
AAGAACATGGATGCATTTTTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCATTCGGGCAATTATTACACG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 12845
Forward primer (5'-3')
AAGAACATGGATGCATTTTTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCATTCGGGCAATTATTACACG
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 12846
Forward primer (5'-3')
AAGAACATGGATGCATTTTTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCATTCGGGCAATTATTACACG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 12847
Forward primer (5'-3')
AAGAACATGGATGCATTTTTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCATTCGGGCAATTATTACACG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 12848
Forward primer (5'-3')
AAGAACATGGATGCATTTTTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCATTCGGGCAATTATTACACG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 12849
Forward primer (5'-3')
AAGAACATGGATGCATTTTTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCATTCGGGCAATTATTACACG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 12850
Forward primer (5'-3')
AAGAACATGGATGCATTTTTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCATTCGGGCAATTATTACACG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 12851
Forward primer (5'-3')
AAGAACATGGATGCATTTTTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCATTCGGGCAATTATTACACG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 12852
Forward primer (5'-3')
AAGAACATGGATGCATTTTTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCATTCGGGCAATTATTACACG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 12853
Forward primer (5'-3')
AAGAACATGGATGCATTTTTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCATTCGGGCAATTATTACACG
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 12854
Forward primer (5'-3')
AAGAACATGGATGCATTTTTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCATTCGGGCAATTATTACACG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 12855
Forward primer (5'-3')
AAGAACATGGATGCATTTTTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCATTCGGGCAATTATTACACG
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 12856
Forward primer (5'-3')
AAGAACATGGATGCATTTTTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCATTCGGGCAATTATTACACG
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 32863
Forward primer (5'-3')
AAGAACATGGATGCATTTTTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCATTCGGGCAATTATTACACG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 32864
Forward primer (5'-3')
AAGAACATGGATGCATTTTTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCATTCGGGCAATTATTACACG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 32865
Forward primer (5'-3')
AAGAACATGGATGCATTTTTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCATTCGGGCAATTATTACACG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 32866
Forward primer (5'-3')
AAGAACATGGATGCATTTTTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCATTCGGGCAATTATTACACG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 400
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At1g77290  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7084 marker 7084
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)