SGN Marker C2_At1g77470

SGN-M7089
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302847 (SGN)
124480 (CGN)
---
Capsicum annuumSingleSGN-U197603---
Lycopersicon CombinedSingleSGN-U222849---
Solanum tuberosumSingleSGN-U250470---
ArabidopsisSingleAt1g77470 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38268)
Chromosome
6
Position
39.10 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39538
Forward primer (5'-3')
TGCCCTACAATCACGATGTACACG
Accessions and product sizes
Solanum lycopersicum TA209
2500
Solanum pennellii TA56
2000
Approximate temperature
55°C
Reverse primer (5'-3')
AAACCACCCTCAGGGACATCAAG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
2500
Solanum pennellii TA56
2000
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25503)
Chromosome
1
Position
29.12 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10455
Forward primer (5'-3')
TGCCCTACAATCACGATGTACACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAACCACCCTCAGGGACATCAAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 2000
Approximate temperature
55°C
  
PCR data   Exp. ID 10456
Forward primer (5'-3')
TGCCCTACAATCACGATGTACACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAACCACCCTCAGGGACATCAAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 2500
Approximate temperature
55°C
  
PCR data   Exp. ID 10457
Forward primer (5'-3')
TGCCCTACAATCACGATGTACACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAACCACCCTCAGGGACATCAAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 2500
Approximate temperature
55°C
  
PCR data   Exp. ID 12857
Forward primer (5'-3')
TGCCCTACAATCACGATGTACACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAACCACCCTCAGGGACATCAAG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 12858
Forward primer (5'-3')
TGCCCTACAATCACGATGTACACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAACCACCCTCAGGGACATCAAG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 12859
Forward primer (5'-3')
TGCCCTACAATCACGATGTACACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAACCACCCTCAGGGACATCAAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 12860
Forward primer (5'-3')
TGCCCTACAATCACGATGTACACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAACCACCCTCAGGGACATCAAG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 12861
Forward primer (5'-3')
TGCCCTACAATCACGATGTACACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAACCACCCTCAGGGACATCAAG
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 12862
Forward primer (5'-3')
TGCCCTACAATCACGATGTACACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAACCACCCTCAGGGACATCAAG
Enzymes
  
Accessions and product sizes
Physalis TA1367: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 12863
Forward primer (5'-3')
TGCCCTACAATCACGATGTACACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAACCACCCTCAGGGACATCAAG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 12864
Forward primer (5'-3')
TGCCCTACAATCACGATGTACACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAACCACCCTCAGGGACATCAAG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 12865
Forward primer (5'-3')
TGCCCTACAATCACGATGTACACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAACCACCCTCAGGGACATCAAG
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 32612
Forward primer (5'-3')
TGCCCTACAATCACGATGTACACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAACCACCCTCAGGGACATCAAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 2000
Approximate temperature
55°C
  
PCR data   Exp. ID 32867
Forward primer (5'-3')
TGCCCTACAATCACGATGTACACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAACCACCCTCAGGGACATCAAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 2000
Approximate temperature
55°C
  
PCR data   Exp. ID 32868
Forward primer (5'-3')
TGCCCTACAATCACGATGTACACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAACCACCCTCAGGGACATCAAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 32869
Forward primer (5'-3')
TGCCCTACAATCACGATGTACACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAACCACCCTCAGGGACATCAAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 32870
Forward primer (5'-3')
TGCCCTACAATCACGATGTACACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAACCACCCTCAGGGACATCAAG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 10458
Forward primer (5'-3')
TGCCCTACAATCACGATGTACACG
Digested band sizes (using amplicon difference)
Solanum pennellii LA716: 2000
Solanum lycopersicum LA925: 2500
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAACCACCCTCAGGGACATCAAG
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
  
Accessions and product sizes
Solanum lycopersicum LA925: 2500
Solanum pennellii LA716: 2000
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At1g77470  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7089 marker 7089
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)