SGN Marker C2_At1g78230

SGN-M7094
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301724 (SGN)
124954 (CGN)
---
Capsicum annuumSingleSGN-U198319---
Lycopersicon CombinedMultipleSGN-U218187---
Solanum tuberosumSingleSGN-U267604---
ArabidopsisSingleAt1g78230 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46615)
Chromosome
4
Position
55.80 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Pepper-COSII   
Map version
58 (location: 41357)
Chromosome
4
Position
104.70 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43333
Forward primer (5'-3')
ACTCTGGGATCACTACCAAAGGGTC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGAGAATTGTAGTTTGCCACAAGCTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38269)
Chromosome
4
Position
82.10 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39539
Forward primer (5'-3')
ACTCTGGGATCACTACCAAAGGGTC
Accessions and product sizes
Solanum lycopersicum TA209
1550
Solanum pennellii TA56
1450
Approximate temperature
55°C
Reverse primer (5'-3')
AGAGAATTGTAGTTTGCCACAAGCTG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
1550
Solanum pennellii TA56
1450
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25508)
Chromosome
1
Position
29.44 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10459
Forward primer (5'-3')
ACTCTGGGATCACTACCAAAGGGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGAATTGTAGTTTGCCACAAGCTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 10460
Forward primer (5'-3')
ACTCTGGGATCACTACCAAAGGGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGAATTGTAGTTTGCCACAAGCTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 10461
Forward primer (5'-3')
ACTCTGGGATCACTACCAAAGGGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGAATTGTAGTTTGCCACAAGCTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 450
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At1g78230F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At1g78230  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7094 marker 7094
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)