SGN Marker C2_At1g78600

SGN-M7096
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301523 (SGN)
124461 (CGN)
---
Capsicum annuumSingleSGN-U199880---
Lycopersicon CombinedSingleSGN-U222957---
Solanum tuberosumSingleSGN-U252577---
ArabidopsisSingleAt1g78600 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46616)
Chromosome
7
Position
12.90 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38270)
Chromosome
12
Position
12.60 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39540
Forward primer (5'-3')
ATGAGAAGGTTCATGCTGCTAATAAG
Accessions and product sizes
Solanum lycopersicum TA209
650
Solanum pennellii TA56
700
Approximate temperature
55°C
Reverse primer (5'-3')
TAATGCCCGATCCTCAAGACAAAAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25510)
Chromosome
1
Position
29.57 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10462
Forward primer (5'-3')
ATGCCTATGTGTGATATCTGCCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCACCAGGATCAACAGGTTCAAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 3000
Approximate temperature
55°C
  
PCR data   Exp. ID 10463
Forward primer (5'-3')
ATGCCTATGTGTGATATCTGCCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCACCAGGATCAACAGGTTCAAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 3000
Approximate temperature
55°C
  
PCR data   Exp. ID 10464
Forward primer (5'-3')
ATGCCTATGTGTGATATCTGCCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCACCAGGATCAACAGGTTCAAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 3000
Approximate temperature
55°C
  
PCR data   Exp. ID 12866
Forward primer (5'-3')
ATGCCTATGTGTGATATCTGCCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCACCAGGATCAACAGGTTCAAG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 12867
Forward primer (5'-3')
ATGCCTATGTGTGATATCTGCCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCACCAGGATCAACAGGTTCAAG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1600
Approximate temperature
55°C
  
PCR data   Exp. ID 12868
Forward primer (5'-3')
ATGCCTATGTGTGATATCTGCCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCACCAGGATCAACAGGTTCAAG
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 1600
Approximate temperature
55°C
  
PCR data   Exp. ID 32871
Forward primer (5'-3')
ATGCCTATGTGTGATATCTGCCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCACCAGGATCAACAGGTTCAAG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 32872
Forward primer (5'-3')
ATGCCTATGTGTGATATCTGCCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCACCAGGATCAACAGGTTCAAG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1600
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Amplicon sequence alignment, FASTA
At1g78600F.cds.txt, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At1g78600  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7096 marker 7096
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)