SGN Marker C2_At1g78690

SGN-M7099
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle310277 (SGN)
128703 (CGN)
---
Lycopersicon CombinedSingleSGN-U221442---
Solanum tuberosumSingleSGN-U256186---
ArabidopsisSingleAt1g78690 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41359)
Chromosome
2
Position
41.20 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43335
Forward primer (5'-3')
TCCAGAAGGGAAGGTCTGTCAAGAAG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGTCATGTACAGACATTTTTGTGCTGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38272)
Chromosome
2
Position
32.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39542
Forward primer (5'-3')
TCCAGAAGGGAAGGTCTGTCAAGAAG
Accessions and product sizes
Solanum lycopersicum TA209
1000
Solanum pennellii TA56
950
Approximate temperature
55°C
Reverse primer (5'-3')
AGTCATGTACAGACATTTTTGTGCTGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25513)
Chromosome
1
Position
29.60 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10469
Forward primer (5'-3')
TCCAGAAGGGAAGGTCTGTCAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTCATGTACAGACATTTTTGTGCTGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 950
Approximate temperature
55°C
  
PCR data   Exp. ID 10470
Forward primer (5'-3')
TCCAGAAGGGAAGGTCTGTCAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTCATGTACAGACATTTTTGTGCTGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 950
Approximate temperature
55°C
  
PCR data   Exp. ID 10471
Forward primer (5'-3')
TCCAGAAGGGAAGGTCTGTCAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTCATGTACAGACATTTTTGTGCTGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 950
Approximate temperature
55°C
  
PCR data   Exp. ID 32228
Forward primer (5'-3')
TCCAGAAGGGAAGGTCTGTCAAGAAG
Digested band sizes (using DpnII)
Solanum pennellii LA716: 200+220+500
Solanum lycopersicum LA925: 220+700
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTCATGTACAGACATTTTTGTGCTGC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI,AseI,BamHI,BslI,BstYI,DpnII,HinfI,NsiI,RsaI,ScaI,StyI
All possible enzymes for lycopersicum and pimpinellifolium: AluI,NsiI
  
Accessions and product sizes
Solanum lycopersicum LA925: 950
Solanum pennellii LA716: 950
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At1g78690F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3 (2), plain text
Forward amplicon sequence for S. hirtum 120061 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120061 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, plain text
Forward amplicon sequence for S. betaceum 04T130, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T130, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #1, plain text
Forward amplicon sequence for S. hirtum 120071 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120071 plant #2, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text
Forward amplicon sequence for S. quitoense SE plant #1 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1 (2), plain text


Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At1g78690F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3 (2), plain text
Forward amplicon sequence for S. hirtum 120061 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120061 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, plain text
Forward amplicon sequence for S. betaceum 04T130, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T130, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #1, plain text
Forward amplicon sequence for S. hirtum 120071 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120071 plant #2, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text
Forward amplicon sequence for S. quitoense SE plant #1 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1 (2), plain text

Genomic location of C2_At1g78690  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7099 marker 7099
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)