Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker SSR37

SGN-M710

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 45
Repeat motif: TA   Repeat number: 10
Repeat motif:    Repeat number:
Forward primer: ATTGAAGACCGAAACGGTTG
Reverse primer: CTGATAAACCCGGCAAGACT
Predicted size: 199
Derivations 
This marker was derived from EST read SGN-E98985
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43804)
Chromosome
1
Position
116.40 cM
Confidence
uncalculated
Protocol
SSR


Sun1642 x LA1589

PCR data   Exp. ID 44814
Forward primer (5'-3')
ATTGAAGACCGAAACGGTTG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CTGATAAACCCGGCAAGACT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43264)
Chromosome
1
Position
117.80 cM
Confidence
uncalculated
Protocol
SSR


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44628
Forward primer (5'-3')
ATTGAAGACCGAAACGGTTG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CTGATAAACCCGGCAAGACT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40764)
Chromosome
1
Position
131.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39239)
Chromosome
1
Position
146.50 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 31843
Forward primer (5'-3')
ATTGAAGACCGAAACGGTTG
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CTGATAAACCCGGCAAGACT
Enzymes
  
Accessions and product sizes
Approximate temperature
45°C
  
Genomic location of SSR37  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D710 marker 710
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)