SGN Marker C2_At1g79260

SGN-M7107
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300782 (SGN)
122437 (CGN)
---
Lycopersicon CombinedMultipleSGN-U223725---
Solanum tuberosumSingleSGN-U252571---
ArabidopsisSingleAt1g79260 on TAIR---
Mapped locations  
Map: Eggplant-RAD 2012   
Map version
174 (location: 132184)
Chromosome
11
Position
47.84 cM
Confidence
uncalculated
Protocol
CAPS


Eggplant-RAD 2012

Map: Pepper-COSII   
Map version
58 (location: 41360)
Chromosome
12
Position
1.70 cM
Confidence
I
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43336
Forward primer (5'-3')
CCATCATGTTATCAGATTTTTAGATGC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CTTCATGAATGCACCCATAAAATAAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38273)
Chromosome
11
Position
37.80 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41180
Forward primer (5'-3')
AACCCGATGGGACCATTGAAGTCG
Accessions and product sizes
Solanum pennellii TA56
750
Solanum lycopersicum TA209
750
Approximate temperature
55°C
Reverse primer (5'-3')
TCTCCACTTTAAAAACTCGAGTTATCTC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
750
Solanum lycopersicum TA209
375
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25521)
Chromosome
1
Position
29.82 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At1g79260  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7107 marker 7107
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)