SGN Marker C2_At1g79600

SGN-M7113
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle311689 (SGN)
127850 (CGN)
---
Lycopersicon CombinedSingleSGN-U219952---
Solanum tuberosumSingleSGN-U245976---
ArabidopsisSingleAt1g79600 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46618)
Chromosome
3
Position
50.40 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46456)
Chromosome
3
Position
53.20 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38274)
Chromosome
4
Position
135.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39543
Forward primer (5'-3')
ACCCGAGTACCTTGAGGAGCTCTC
Accessions and product sizes
Solanum pennellii TA56
1000
Approximate temperature
58°C
Reverse primer (5'-3')
AGATCCAAAAACCTTTAGCCCTTG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
900
Solanum lycopersicum TA209
1000
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25527)
Chromosome
1
Position
29.96 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g79600  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7113 marker 7113
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)