SGN Marker C2_At1g80170

SGN-M7124
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumMultipleSGN-U205417---
Lycopersicon CombinedSingleSGN-U223469---
Solanum tuberosumSingleSGN-U245667---
ArabidopsisSingleAt1g80170 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46620)
Chromosome
3
Position
52.20 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46457)
Chromosome
3
Position
74.40 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Pepper-COSII   
Map version
58 (location: 41363)
Chromosome
3
Position
125.30 cM
Confidence
I(LOD2)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43339
Forward primer (5'-3')
TTTAACTTTCCACAAATGCAACAACC
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
TCTTTATTCTAACCCCGTTCTCAGTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38280)
Chromosome
3
Position
122.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39546
Forward primer (5'-3')
TTTAACTTTCCACAAATGCAACAACC
Accessions and product sizes
Solanum lycopersicum TA209
1100
Solanum pennellii TA56
1100
Approximate temperature
55°C
Reverse primer (5'-3')
TCTTTATTCTAACCCCGTTCTCAGTG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
450
Solanum pennellii TA56
450
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25538)
Chromosome
1
Position
30.16 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g80170  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7124 marker 7124
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)