SGN Marker C2_At1g80360

SGN-M7127
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle309538 (SGN)
126283 (CGN)
---
Solanum tuberosumSingleSGN-U245542---
ArabidopsisSingleAt1g80360 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46621)
Chromosome
3
Position
70.30 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38281)
Chromosome
3
Position
149.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39547
Forward primer (5'-3')
ATGGTTACTGCCGGTGCAAATCAG
Accessions and product sizes
Solanum pennellii TA56
200
Solanum lycopersicum TA209
200
Approximate temperature
55°C
Reverse primer (5'-3')
TCGGTAACACCTGTCATCTGGAATG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
200
Solanum pennellii TA56
150
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25541)
Chromosome
1
Position
30.21 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10484
Forward primer (5'-3')
ATGGTTACTGCCGGTGCAAATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGGTAACACCTGTCATCTGGAATG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 10485
Forward primer (5'-3')
ATGGTTACTGCCGGTGCAAATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGGTAACACCTGTCATCTGGAATG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 10486
Forward primer (5'-3')
ATGGTTACTGCCGGTGCAAATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGGTAACACCTGTCATCTGGAATG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 12870
Forward primer (5'-3')
ATGGTTACTGCCGGTGCAAATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGGTAACACCTGTCATCTGGAATG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 12871
Forward primer (5'-3')
ATGGTTACTGCCGGTGCAAATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGGTAACACCTGTCATCTGGAATG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 12872
Forward primer (5'-3')
ATGGTTACTGCCGGTGCAAATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGGTAACACCTGTCATCTGGAATG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 380
Approximate temperature
55°C
  
PCR data   Exp. ID 12873
Forward primer (5'-3')
ATGGTTACTGCCGGTGCAAATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGGTAACACCTGTCATCTGGAATG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 380
Approximate temperature
55°C
  
PCR data   Exp. ID 12874
Forward primer (5'-3')
ATGGTTACTGCCGGTGCAAATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGGTAACACCTGTCATCTGGAATG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 380
Approximate temperature
55°C
  
PCR data   Exp. ID 12875
Forward primer (5'-3')
ATGGTTACTGCCGGTGCAAATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGGTAACACCTGTCATCTGGAATG
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 380
Approximate temperature
55°C
  
PCR data   Exp. ID 12876
Forward primer (5'-3')
ATGGTTACTGCCGGTGCAAATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGGTAACACCTGTCATCTGGAATG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 12877
Forward primer (5'-3')
ATGGTTACTGCCGGTGCAAATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGGTAACACCTGTCATCTGGAATG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 12878
Forward primer (5'-3')
ATGGTTACTGCCGGTGCAAATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGGTAACACCTGTCATCTGGAATG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 12879
Forward primer (5'-3')
ATGGTTACTGCCGGTGCAAATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGGTAACACCTGTCATCTGGAATG
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 32614
Forward primer (5'-3')
ATGGTTACTGCCGGTGCAAATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGGTAACACCTGTCATCTGGAATG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 32875
Forward primer (5'-3')
ATGGTTACTGCCGGTGCAAATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGGTAACACCTGTCATCTGGAATG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 32876
Forward primer (5'-3')
ATGGTTACTGCCGGTGCAAATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGGTAACACCTGTCATCTGGAATG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 32877
Forward primer (5'-3')
ATGGTTACTGCCGGTGCAAATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGGTAACACCTGTCATCTGGAATG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 380
Approximate temperature
55°C
  
PCR data   Exp. ID 32878
Forward primer (5'-3')
ATGGTTACTGCCGGTGCAAATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGGTAACACCTGTCATCTGGAATG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 380
Approximate temperature
55°C
  
PCR data   Exp. ID 32879
Forward primer (5'-3')
ATGGTTACTGCCGGTGCAAATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGGTAACACCTGTCATCTGGAATG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 380
Approximate temperature
55°C
  
PCR data   Exp. ID 10487
Forward primer (5'-3')
ATGGTTACTGCCGGTGCAAATCAG
Digested band sizes (using HinfI)
Solanum pennellii LA716: 1400
Solanum lycopersicum LA925: 450+500
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGGTAACACCTGTCATCTGGAATG
Enzymes
All possible enzymes for pennellii and and lycopersicum: HinfI
  
Accessions and product sizes
Solanum pennellii LA716: 1400
Solanum lycopersicum LA925: 1400
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At1g80360  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7127 marker 7127
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)