SGN Marker C2_At2g01720

SGN-M7141
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeMultiple300846 (SGN)
121141 (CGN)
---
Capsicum annuumSingleSGN-U200161---
Lycopersicon CombinedSingleSGN-U218512---
Solanum tuberosumSingleSGN-U246003---
ArabidopsisSingleAt2g01720 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46624)
Chromosome
5
Position
45.40 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38286)
Chromosome
5
Position
119.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39551
Forward primer (5'-3')
ACAAATTGGTACATGCTGGTGCTC
Accessions and product sizes
Solanum lycopersicum TA209
1100
Solanum pennellii TA56
1100
Approximate temperature
55°C
Reverse primer (5'-3')
TGGCCTGTTAGACTGATATTCAAC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
1100
Solanum pennellii TA56
950
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25556)
Chromosome
2
Position
0.32 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10501
Forward primer (5'-3')
ACAAATTGGTACATGCTGGTGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCCTGTTAGACTGATATTCAAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 10502
Forward primer (5'-3')
ACAAATTGGTACATGCTGGTGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCCTGTTAGACTGATATTCAAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 10503
Forward primer (5'-3')
ACAAATTGGTACATGCTGGTGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCCTGTTAGACTGATATTCAAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 12899
Forward primer (5'-3')
ACAAATTGGTACATGCTGGTGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCCTGTTAGACTGATATTCAAC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 12900
Forward primer (5'-3')
ACAAATTGGTACATGCTGGTGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCCTGTTAGACTGATATTCAAC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 380
Approximate temperature
55°C
  
PCR data   Exp. ID 12901
Forward primer (5'-3')
ACAAATTGGTACATGCTGGTGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCCTGTTAGACTGATATTCAAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 12902
Forward primer (5'-3')
ACAAATTGGTACATGCTGGTGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCCTGTTAGACTGATATTCAAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 12903
Forward primer (5'-3')
ACAAATTGGTACATGCTGGTGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCCTGTTAGACTGATATTCAAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 12904
Forward primer (5'-3')
ACAAATTGGTACATGCTGGTGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCCTGTTAGACTGATATTCAAC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 12905
Forward primer (5'-3')
ACAAATTGGTACATGCTGGTGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCCTGTTAGACTGATATTCAAC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 12906
Forward primer (5'-3')
ACAAATTGGTACATGCTGGTGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCCTGTTAGACTGATATTCAAC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 12907
Forward primer (5'-3')
ACAAATTGGTACATGCTGGTGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCCTGTTAGACTGATATTCAAC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 12908
Forward primer (5'-3')
ACAAATTGGTACATGCTGGTGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCCTGTTAGACTGATATTCAAC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 350+520
Approximate temperature
55°C
  
PCR data   Exp. ID 32617
Forward primer (5'-3')
ACAAATTGGTACATGCTGGTGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCCTGTTAGACTGATATTCAAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 32890
Forward primer (5'-3')
ACAAATTGGTACATGCTGGTGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCCTGTTAGACTGATATTCAAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 32891
Forward primer (5'-3')
ACAAATTGGTACATGCTGGTGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCCTGTTAGACTGATATTCAAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 32892
Forward primer (5'-3')
ACAAATTGGTACATGCTGGTGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCCTGTTAGACTGATATTCAAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 32893
Forward primer (5'-3')
ACAAATTGGTACATGCTGGTGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCCTGTTAGACTGATATTCAAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 32894
Forward primer (5'-3')
ACAAATTGGTACATGCTGGTGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCCTGTTAGACTGATATTCAAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 10504
Forward primer (5'-3')
ACAAATTGGTACATGCTGGTGCTC
Digested band sizes (using DraI)
Solanum pennellii LA716: 500
Solanum lycopersicum LA925: 150+250
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCCTGTTAGACTGATATTCAAC
Enzymes
All possible enzymes for pennellii and and lycopersicum: DraI
All possible enzymes for lycopersicum and pimpinellifolium: DraI
  
Accessions and product sizes
Solanum lycopersicum LA925: 500
Solanum pennellii LA716: 500
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At2g01720  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7141 marker 7141
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)