Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker C2_At2g03120

SGN-M7150
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle306709 (SGN)
125879 (CGN)
---
Lycopersicon CombinedMultipleSGN-U220002---
Solanum tuberosumSingleSGN-U258888---
ArabidopsisSingleAt2g03120 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38288)
Chromosome
1
Position
18.20 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39553
Forward primer (5'-3')
TGCAACACTGTTACCTGCTATCAAACG
Accessions and product sizes
Solanum pennellii TA56
300
Solanum lycopersicum TA209
300
Approximate temperature
55°C
Reverse primer (5'-3')
AACATGGTTCCAGGAATTGCAGCAAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25565)
Chromosome
2
Position
0.94 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10508
Forward primer (5'-3')
TGCAACACTGTTACCTGCTATCAAACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACATGGTTCCAGGAATTGCAGCAAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 10509
Forward primer (5'-3')
TGCAACACTGTTACCTGCTATCAAACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACATGGTTCCAGGAATTGCAGCAAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 10510
Forward primer (5'-3')
TGCAACACTGTTACCTGCTATCAAACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACATGGTTCCAGGAATTGCAGCAAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 10511
Forward primer (5'-3')
TGCAACACTGTTACCTGCTATCAAACG
Digested band sizes (using XbaI)
Solanum lycopersicum LA925: 400
Solanum pennellii LA716: 500
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACATGGTTCCAGGAATTGCAGCAAC
Enzymes
All possible enzymes for pennellii and and lycopersicum: TspRI,XbaI
All possible enzymes for lycopersicum and pimpinellifolium: Bme1580I/BseSI,BmyI/Bsp1286I/MhlI/SduI
  
Accessions and product sizes
Solanum lycopersicum LA925: 500
Solanum pennellii LA716: 500
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At2g03120F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At2g03120  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7150 marker 7150
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)