SGN Marker C2_At2g06530

SGN-M7182
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304024 (SGN)
123326 (CGN)
---
Lycopersicon CombinedSingleSGN-U216673---
Solanum tuberosumSingleSGN-U249207---
ArabidopsisSingleAt2g06530 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41369)
Chromosome
9
Position
106.90 cM
Confidence
F(LOD3)
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43345
Forward primer (5'-3')
AAGGTGTCTCCCTCAGAATTCAG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGTCTTCAAGACAACCAAATATATTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38296)
Chromosome
12
Position
32.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39561
Forward primer (5'-3')
AAGGTGTCTCCCTCAGAATTCAG
Accessions and product sizes
Solanum lycopersicum TA209
150
Solanum pennellii TA56
150
Approximate temperature
55°C
Reverse primer (5'-3')
ATCTGTCCCATTGCCTTTGTAAC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
100
Solanum pennellii TA56
150
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25597)
Chromosome
2
Position
2.59 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10541
Forward primer (5'-3')
AAGGTGTCTCCCTCAGAATTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTGTCCCATTGCCTTTGTAAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 10542
Forward primer (5'-3')
AAGGTGTCTCCCTCAGAATTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTGTCCCATTGCCTTTGTAAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 10543
Forward primer (5'-3')
AAGGTGTCTCCCTCAGAATTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTGTCCCATTGCCTTTGTAAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12909
Forward primer (5'-3')
AAGGTGTCTCCCTCAGAATTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTGTCCCATTGCCTTTGTAAC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 12910
Forward primer (5'-3')
AAGGTGTCTCCCTCAGAATTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTGTCCCATTGCCTTTGTAAC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 12911
Forward primer (5'-3')
AAGGTGTCTCCCTCAGAATTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTGTCCCATTGCCTTTGTAAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 12912
Forward primer (5'-3')
AAGGTGTCTCCCTCAGAATTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTGTCCCATTGCCTTTGTAAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 12913
Forward primer (5'-3')
AAGGTGTCTCCCTCAGAATTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTGTCCCATTGCCTTTGTAAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 950
Approximate temperature
55°C
  
PCR data   Exp. ID 12914
Forward primer (5'-3')
AAGGTGTCTCCCTCAGAATTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTGTCCCATTGCCTTTGTAAC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 12915
Forward primer (5'-3')
AAGGTGTCTCCCTCAGAATTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTGTCCCATTGCCTTTGTAAC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 12916
Forward primer (5'-3')
AAGGTGTCTCCCTCAGAATTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTGTCCCATTGCCTTTGTAAC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 12917
Forward primer (5'-3')
AAGGTGTCTCCCTCAGAATTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTGTCCCATTGCCTTTGTAAC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 12918
Forward primer (5'-3')
AAGGTGTCTCCCTCAGAATTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTGTCCCATTGCCTTTGTAAC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 32618
Forward primer (5'-3')
AAGGTGTCTCCCTCAGAATTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTGTCCCATTGCCTTTGTAAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 32895
Forward primer (5'-3')
AAGGTGTCTCCCTCAGAATTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTGTCCCATTGCCTTTGTAAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 32896
Forward primer (5'-3')
AAGGTGTCTCCCTCAGAATTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTGTCCCATTGCCTTTGTAAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 32897
Forward primer (5'-3')
AAGGTGTCTCCCTCAGAATTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTGTCCCATTGCCTTTGTAAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 32898
Forward primer (5'-3')
AAGGTGTCTCCCTCAGAATTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTGTCCCATTGCCTTTGTAAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 32899
Forward primer (5'-3')
AAGGTGTCTCCCTCAGAATTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTGTCCCATTGCCTTTGTAAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 950
Approximate temperature
55°C
  
PCR data   Exp. ID 10544
Forward primer (5'-3')
AAGGTGTCTCCCTCAGAATTCAG
Digested band sizes (using RsaI)
Solanum pennellii LA716: 450
Solanum lycopersicum LA925: 400
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTGTCCCATTGCCTTTGTAAC
Enzymes
All possible enzymes for pennellii and and lycopersicum: RsaI
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Solanum pennellii LA716: 750
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. quitoense plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, plain text
Forward amplicon sequence for S. betaceum 04T130, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T130, plain text
Forward amplicon sequence for S. betaceum 04T132, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T132, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, plain text
Forward amplicon sequence for S. hirtum 120060 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120060 plant #1, plain text
Forward amplicon sequence for S. hirtum 120062 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #1, plain text
Forward amplicon sequence for S. hirtum 120071 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120071 plant #2, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text


Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. quitoense plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, plain text
Forward amplicon sequence for S. betaceum 04T130, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T130, plain text
Forward amplicon sequence for S. betaceum 04T132, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T132, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, plain text
Forward amplicon sequence for S. hirtum 120060 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120060 plant #1, plain text
Forward amplicon sequence for S. hirtum 120062 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #1, plain text
Forward amplicon sequence for S. hirtum 120071 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120071 plant #2, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At2g06530  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7182 marker 7182
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)