SGN Marker C2_At2g06925

SGN-M7183
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U201743---
Lycopersicon CombinedSingleSGN-U224692---
Solanum tuberosumSingleSGN-U251463---
ArabidopsisSingleAt2g06925 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49226)
Chromosome
7
Position
5.20 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47157)
Chromosome
7
Position
23.60 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46627)
Chromosome
11
Position
37.90 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38297)
Chromosome
7
Position
19.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39562
Forward primer (5'-3')
AGAATGCAGTAGAACATGTGAATCAAAG
Accessions and product sizes
Solanum lycopersicum TA209
325
Solanum pennellii TA56
325
Approximate temperature
55°C
Reverse primer (5'-3')
AATCATGCTTCATACAACAAGCATCAAG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
150
Solanum lycopersicum TA209
325
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25598)
Chromosome
2
Position
2.84 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10545
Forward primer (5'-3')
AGAATGCAGTAGAACATGTGAATCAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCATGCTTCATACAACAAGCATCAAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 240
Approximate temperature
55°C
  
PCR data   Exp. ID 10546
Forward primer (5'-3')
AGAATGCAGTAGAACATGTGAATCAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCATGCTTCATACAACAAGCATCAAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 240
Approximate temperature
55°C
  
PCR data   Exp. ID 10547
Forward primer (5'-3')
AGAATGCAGTAGAACATGTGAATCAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCATGCTTCATACAACAAGCATCAAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 240
Approximate temperature
55°C
  
PCR data   Exp. ID 10548
Forward primer (5'-3')
AGAATGCAGTAGAACATGTGAATCAAAG
Digested band sizes (using ApoI)
Solanum lycopersicum LA925: 90+140
Solanum pennellii LA716: 90+150
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCATGCTTCATACAACAAGCATCAAG
Enzymes
All possible enzymes for pennellii and and lycopersicum: ApoI
  
Accessions and product sizes
Solanum pennellii LA716: 240
Solanum lycopersicum LA925: 240
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At2g06925F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At2g06925  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7183 marker 7183
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)