SGN Marker C2_At2g14260

SGN-M7194
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle306024 (SGN)
131660 (CGN)
---
Capsicum annuumSingleSGN-U198059---
Lycopersicon CombinedSingleSGN-U220663---
Solanum tuberosumSingleSGN-U253479---
ArabidopsisSingleAt2g14260 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46628)
Chromosome
3
Position
4.70 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38298)
Chromosome
11
Position
46.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39563
Forward primer (5'-3')
AGGATCTATACCCCTCTATAGAGCC
Accessions and product sizes
Solanum lycopersicum TA209
700
Solanum pennellii TA56
700
Approximate temperature
55°C
Reverse primer (5'-3')
TTATTGGGTGAAGTCCCACCTCC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
700
Solanum pennellii TA56
310+390
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25609)
Chromosome
2
Position
6.05 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10555
Forward primer (5'-3')
AGGATCTATACCCCTCTATAGAGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTATTGGGTGAAGTCCCACCTCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1450
Approximate temperature
55°C
  
PCR data   Exp. ID 10556
Forward primer (5'-3')
AGGATCTATACCCCTCTATAGAGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTATTGGGTGAAGTCCCACCTCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1450
Approximate temperature
55°C
  
PCR data   Exp. ID 10557
Forward primer (5'-3')
AGGATCTATACCCCTCTATAGAGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTATTGGGTGAAGTCCCACCTCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1450
Approximate temperature
55°C
  
PCR data   Exp. ID 32230
Forward primer (5'-3')
AGGATCTATACCCCTCTATAGAGCC
Digested band sizes (using CfoI)
Solanum lycopersicum LA925: 400+1050
Solanum pennellii LA716: 300+400+750
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTATTGGGTGAAGTCCCACCTCC
Enzymes
All possible enzymes for pennellii and and lycopersicum: BglII,BstNI,BstYI,CfoI/HhaI,ScrFI
All possible enzymes for lycopersicum and pimpinellifolium: TspRI
  
Accessions and product sizes
Solanum lycopersicum LA925: 1450
Solanum pennellii LA716: 1450
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Amplicon sequence alignment, FASTA
At2g14260F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At2g14260  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7194 marker 7194
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)