SGN Marker C2_At2g14910

SGN-M7197
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle299647 (SGN)
124755 (CGN)
---
Capsicum annuumSingleSGN-U198921---
Lycopersicon CombinedMultipleSGN-U214424---
Solanum tuberosumSingleSGN-U245404---
ArabidopsisSingleAt2g14910 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38300)
Chromosome
1
Position
150.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41205
Forward primer (5'-3')
TGATGCAATGAAAAGAACTATATCAGG
Accessions and product sizes
Solanum pennellii TA56
200
Solanum lycopersicum TA209
200
Approximate temperature
55°C
Reverse primer (5'-3')
TCAATGTTCTTTTCAAGACAAAGCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25612)
Chromosome
2
Position
6.41 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10558
Forward primer (5'-3')
TTTGATCTCTTCAATGATGACTGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAATGTTCTTTTCAAGACAAAGCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 700
Approximate temperature
53°C
  
PCR data   Exp. ID 10559
Forward primer (5'-3')
TTTGATCTCTTCAATGATGACTGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAATGTTCTTTTCAAGACAAAGCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 700
Approximate temperature
53°C
  
PCR data   Exp. ID 10560
Forward primer (5'-3')
TTTGATCTCTTCAATGATGACTGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAATGTTCTTTTCAAGACAAAGCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 700
Approximate temperature
53°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At2g14910  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7197 marker 7197
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)