SGN Marker C2_At2g16920

SGN-M7212
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302789 (SGN)
119872 (CGN)
---
Capsicum annuumSingleSGN-U202957---
ArabidopsisSingleAt2g16920 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46629)
Chromosome
1
Position
54.40 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Pepper-COSII   
Map version
58 (location: 41371)
Chromosome
1
Position
252.30 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43347
Forward primer (5'-3')
TGCAAGACAATGATGTATCTGATGAGG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TCCTAAAGTGCTCTCTGATAAGCTCTTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38305)
Chromosome
1
Position
165.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39568
Forward primer (5'-3')
TGCAAGACAATGATGTATCTGATGAGG
Accessions and product sizes
Solanum pennellii TA56
100
Solanum lycopersicum TA209
100
Approximate temperature
53°C
Reverse primer (5'-3')
TCCTAAAGTGCTCTCTGATAAGCTCTTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25628)
Chromosome
2
Position
7.34 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10573
Forward primer (5'-3')
TGCAAGACAATGATGTATCTGATGAGG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TCCTAAAGTGCTCTCTGATAAGCTCTTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 10574
Forward primer (5'-3')
TGCAAGACAATGATGTATCTGATGAGG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TCCTAAAGTGCTCTCTGATAAGCTCTTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 10575
Forward primer (5'-3')
TGCAAGACAATGATGTATCTGATGAGG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TCCTAAAGTGCTCTCTGATAAGCTCTTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 12928
Forward primer (5'-3')
TGCAAGACAATGATGTATCTGATGAGG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TCCTAAAGTGCTCTCTGATAAGCTCTTC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 200+1350
Approximate temperature
55°C
  
PCR data   Exp. ID 12929
Forward primer (5'-3')
TGCAAGACAATGATGTATCTGATGAGG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TCCTAAAGTGCTCTCTGATAAGCTCTTC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 200+1350
Approximate temperature
55°C
  
PCR data   Exp. ID 12930
Forward primer (5'-3')
TGCAAGACAATGATGTATCTGATGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTAAAGTGCTCTCTGATAAGCTCTTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1050
Approximate temperature
55°C
  
PCR data   Exp. ID 12931
Forward primer (5'-3')
TGCAAGACAATGATGTATCTGATGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTAAAGTGCTCTCTGATAAGCTCTTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1050
Approximate temperature
55°C
  
PCR data   Exp. ID 12932
Forward primer (5'-3')
TGCAAGACAATGATGTATCTGATGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTAAAGTGCTCTCTGATAAGCTCTTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 12933
Forward primer (5'-3')
TGCAAGACAATGATGTATCTGATGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTAAAGTGCTCTCTGATAAGCTCTTC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 12934
Forward primer (5'-3')
TGCAAGACAATGATGTATCTGATGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTAAAGTGCTCTCTGATAAGCTCTTC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 12935
Forward primer (5'-3')
TGCAAGACAATGATGTATCTGATGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTAAAGTGCTCTCTGATAAGCTCTTC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 12936
Forward primer (5'-3')
TGCAAGACAATGATGTATCTGATGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTAAAGTGCTCTCTGATAAGCTCTTC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 12937
Forward primer (5'-3')
TGCAAGACAATGATGTATCTGATGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTAAAGTGCTCTCTGATAAGCTCTTC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 32619
Forward primer (5'-3')
TGCAAGACAATGATGTATCTGATGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTAAAGTGCTCTCTGATAAGCTCTTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 32901
Forward primer (5'-3')
TGCAAGACAATGATGTATCTGATGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTAAAGTGCTCTCTGATAAGCTCTTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 32902
Forward primer (5'-3')
TGCAAGACAATGATGTATCTGATGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTAAAGTGCTCTCTGATAAGCTCTTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 32903
Forward primer (5'-3')
TGCAAGACAATGATGTATCTGATGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTAAAGTGCTCTCTGATAAGCTCTTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1050
Approximate temperature
55°C
  
PCR data   Exp. ID 32904
Forward primer (5'-3')
TGCAAGACAATGATGTATCTGATGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTAAAGTGCTCTCTGATAAGCTCTTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1050
Approximate temperature
55°C
  
PCR data   Exp. ID 32905
Forward primer (5'-3')
TGCAAGACAATGATGTATCTGATGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTAAAGTGCTCTCTGATAAGCTCTTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 32906
Forward primer (5'-3')
TGCAAGACAATGATGTATCTGATGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTAAAGTGCTCTCTGATAAGCTCTTC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 10576
Forward primer (5'-3')
TGCAAGACAATGATGTATCTGATGAGG
Digested band sizes (using amplicon difference)
Solanum lycopersicum LA925: 850
Solanum pennellii LA716: 1650
Mg+2 concentration
3mM
Reverse primer (5'-3')
TCCTAAAGTGCTCTCTGATAAGCTCTTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
All possible enzymes for lycopersicum and pimpinellifolium: amplicon difference
  
Accessions and product sizes
Solanum pennellii LA716: 1650
Solanum lycopersicum LA925: 850
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At2g16920  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7212 marker 7212
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)