SGN Marker C2_At2g17695

SGN-M7219
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U198471---
Lycopersicon CombinedMultipleSGN-U213839---
Solanum tuberosumSingleSGN-U252902---
ArabidopsisSingleAt2g17695 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38306)
Chromosome
2
Position
83.30 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41210
Forward primer (5'-3')
AGATTTAGAGGAACTACTGAGAAACCTG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
AACGCCCAATTCAATCCAAAATGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25635)
Chromosome
2
Position
7.69 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At2g17695  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7219 marker 7219
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)