SGN Marker SSR49

SGN-M722

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 40.909
Repeat motif: TC   Repeat number: 6
Repeat motif: AC   Repeat number: 4
Repeat motif:    Repeat number:
Forward primer: TCTCAAAGTCGTTCCTTCTTGA
Reverse primer: GGAAGAGAAACGCGGACATA
Predicted size: 161
Derivations 
This marker was derived from EST read SGN-E176165
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39254)
Chromosome
5
Position
106.00 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14115
Forward primer (5'-3')
TCTCAAAGTCGTTCCTTCTTGA
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
GGAAGAGAAACGCGGACATA
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 148+161
Solanum pimpinellifolium LA1589: 161
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR49 was used as an overgo probe on plate 11 [well H5]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCCATTCCACCTTTGCTTCACGCT
B sequence
AGAGAAACGCGGACATAGCGTGAA
AB sequence
TCCATTCCACCTTTGCTTCACGCTATGTCC
Marker sequence
GAATTAATTCTCTCAAAGTCGTTCCTTCTTGAGAAAAAAGAACACACACT
CTCTCTCTCTCCTCCATCCACCACCATTCACCACCACCATGGTCATATCC
AAGGCCGCCTCGGAGTCGGATCTCTCCGTCCATTCCACCTTTGCTTCACG
CTATGTCCGCGTTTCTCTTCCCCGGTTTAAGATGCCGGAGAATTCGATAC
CAAAGGATGCAGCATATCAAATAATAAATGATGAATTAATGTTGGATGGA
AATCCAAGGCTTAATTTAGCTTCATTTGTGACAACATGGATGGAACCAGA
ATGTGATAAGCTAATCATGGATTCAATTAACAAGAATTATGTTGACATGG
ATGAATACCCTGTCACCACTGAGCTTCAGAATCGATGTGTAAACATGATA
GCCCATTTATTTAATGCACCATTGGGAGAGGGAGAGGCTGCTGTTGGAGT
TGGAACAGTTGGATCCTCAGAAGCCATTATGCTTGCTGGATTAGCCTTTA
AGAGAAAATGGCAAAACAAAATGAAGGCCCAAGGAAAGCCTCATGACAAG
CCCAATATTGTTACTGGGGCCAATGTCCAGGTATGCTGGGAAAAATTTGC
GAGGTACTTCGAAGTAGAATTAAAAGAAGTGAAATT
Genomic location of SSR49  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D722 marker 722
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)