SGN Marker SSR50

SGN-M723

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 40 High: 55
Repeat motif: TC   Repeat number: 6
Repeat motif: CCTTC   Repeat number: 2
Repeat motif:    Repeat number:
Forward primer: CCGTGACCCTCTTTACAAGC
Reverse primer: TTGCTTTCTTCTTCGCCATT
Predicted size: 205
Derivations 
This marker was derived from EST read SGN-E172364
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39256)
Chromosome
2
Position
70.50 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 31746
Forward primer (5'-3')
CCGTGACCCTCTTTACAAGC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TTGCTTTCTTCTTCGCCATT
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 205
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
SSR50 was used as an overgo probe on plate 10 [well D12]

Plausible BAC Matches:   P256J01

 Overgo Sequences

A sequence
GACCCTCTTTACAAGCAAAACCCG
B sequence
GAAGGGAAGGAGGATTCGGGTTTT
AB sequence
GACCCTCTTTACAAGCAAAACCCGAATCCT
Marker sequence
GCCGTGACCCTCTTTACAAGCAAAACCCGAATCCTCCTTCCCTTCTCTCT
CTCTCTCTGTCTCAGACTCACCAAGAGAGATAAAAACTAATCTTTCTTGA
CAGAGAAAGAAGAGATTTCTGATTCATATATATACATACATACAGTAAAT
AGATATACGTATATAGCGCGGTAAAGGGTGAGAAGGAATGGCGAAGAAGA
AAGCAACCATGACTCTTAAAGACTTCCATGGTGGTTCTATTCCTTCAGAT
CTTCCATTACCTTCTGCCCCTGGCGTAATGATAAGACCATCGGATCGTGG
TGGTTTTGATCGCCAAGCATCATGGGGAAACCCCATGGGAAGACCAGAGC
ATCGTTTACGTCCGGGATCAGCTGGTGCAACCAGAAACTTTGACGAGAAG
ACTCCTTTCTTAAGTCATAATGCACCAATAGGCCGTAATTTTGATGAGGA
TGAGAGGAAGCCATTGGATGGATCATCTGGACCTCGTCGAACTGTTAGTG
ATGAGAGTATCCGTGCATTGCCAAGTCGTGTGGAGCCTAAGGCAGAATAC
TCTGTTACTGGGATGGTAGGTAGTGGGCAAGTATCAGCTCCTCCGTCTCA
AAAT
Genomic location of SSR50  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D723 marker 723
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)