SGN Marker SSR51

SGN-M724

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 45.455 High: 55
Repeat motif: ACAA   Repeat number: 6
Repeat motif:    Repeat number:
Forward primer: CTACCCTGGTCTTGGTGGAA
Reverse primer: AAAGGATGCTCTAGCTTCTCCA
Predicted size: 148
Derivations 
This marker was derived from EST read SGN-E172309
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49373)
Chromosome
1
Position
69.63 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47308)
Chromosome
1
Position
43.20 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39257)
Chromosome
1
Position
39.50 cM
Confidence
F(LOD3)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 6
Forward primer (5'-3')
CTACCCTGGTCTTGGTGGAA
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAAGGATGCTCTAGCTTCTCCA
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 148+148
Solanum lycopersicum LA925: 128+148
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR51 was used as an overgo probe on plate 9 [well A9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CCTGAGGGATATCTGATTTGGGAG
B sequence
AATTTGGCTTGTCGGCCTCCCAAA
AB sequence
CCTGAGGGATATCTGATTTGGGAGGCCGAC
Marker sequence
GTACTTCAGAACTGCAAAATTGTACCAGAACAATCACTCTTTGATGATAG
GTTCAAATACGAACACTACTTAACGCGCCCATGGAAGGCATATTCCACCA
ATGTTTTCATGGAAAGTGAGATCGGTGACCTCATCAGGCCTGAGGGATAT
CTGATTTGGGAGGCCGACAAGCCAAATTTTTTCGAACAGACATGTGAAGT
GTATGAATATGCAAACAGAGGACCTGGTGCTAACACTAACGGAAGGAGCA
AACTCTTCAAGAAGTTCAAGGTTCTTAGCCCACAGGAAGCTACTAAATAC
ACCGCTGCCACTTTCCTTCAAGCTAATGAATGGTTGCCTGGAACCAGTGC
ACCTTTCTACCCTGGTCTTGGTGGAAAATAGATCATCACAAACAAACAAA
CAAACAAACAAACATCATTTTCCCTACTTCTCAACACCCCTTTCTCTACC
TACCAATTCAATATTCTTCTTTCATTTTTTGTTGGAGAAGCTAGAGCATC
CTTTTGTTAGCAAAAAAAAAAATGATGCATACTTTTGTTCTTTTTGTGTA
TGTAACCAATTC
Genomic location of SSR51  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D724 marker 724
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)