SGN Marker C2_At2g24580

SGN-M7286
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U196987---
Lycopersicon CombinedSingleSGN-U237214---
Solanum tuberosumSingleSGN-U267323---
ArabidopsisSingleAt2g24580 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46632)
Chromosome
12
Position
21.40 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46462)
Chromosome
10
Position
69.20 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. acuminata

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38323)
Chromosome
8
Position
2.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39583
Forward primer (5'-3')
TCATTGGAGCTGGTATAATGGGTAG
Accessions and product sizes
Solanum pennellii TA56
1200
Solanum lycopersicum TA209
1200
Approximate temperature
55°C
Reverse primer (5'-3')
AGCCATTTCCAATAGTGAATTTTGACTC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
750
Solanum pennellii TA56
600
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25702)
Chromosome
2
Position
10.45 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At2g24580  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7286 marker 7286
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)