SGN Marker C2_At2g25730

SGN-M7298
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303702 (SGN)
120676 (CGN)
---
Capsicum annuumSingleSGN-U199740---
ArabidopsisSingleAt2g25730 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 25714)
Chromosome
2
Position
10.97 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41235
Forward primer (5'-3')
ATGAAAAATACAGCATGGCTGTTCACAC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TGCCCCCATGCATTCCACAAGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At2g25730  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7298 marker 7298
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)