SGN Marker C2_At2g26590

SGN-M7313
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300895 (SGN)
124974 (CGN)
---
Capsicum annuumSingleSGN-U198088---
Lycopersicon CombinedSingleSGN-U218497---
Solanum tuberosumSingleSGN-U246712---
ArabidopsisSingleAt2g26590 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38332)
Chromosome
7
Position
15.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39589
Forward primer (5'-3')
AGCCAGCAGCTGACAATGATGCAC
Accessions and product sizes
Solanum lycopersicum TA209
900
Solanum pennellii TA56
950
Approximate temperature
55°C
Reverse primer (5'-3')
TGGTAAAGGAGCTGAAGCTTCAGG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
900
Solanum pennellii TA56
950
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25730)
Chromosome
2
Position
11.32 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10681
Forward primer (5'-3')
AGCCAGCAGCTGACAATGATGCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGTAAAGGAGCTGAAGCTTCAGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 950
Approximate temperature
55°C
  
PCR data   Exp. ID 10682
Forward primer (5'-3')
AGCCAGCAGCTGACAATGATGCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGTAAAGGAGCTGAAGCTTCAGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 10683
Forward primer (5'-3')
AGCCAGCAGCTGACAATGATGCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGTAAAGGAGCTGAAGCTTCAGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 12999
Forward primer (5'-3')
AGCCAGCAGCTGACAATGATGCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGTAAAGGAGCTGAAGCTTCAGG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 13000
Forward primer (5'-3')
AGCCAGCAGCTGACAATGATGCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGTAAAGGAGCTGAAGCTTCAGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 13001
Forward primer (5'-3')
AGCCAGCAGCTGACAATGATGCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGTAAAGGAGCTGAAGCTTCAGG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 13002
Forward primer (5'-3')
AGCCAGCAGCTGACAATGATGCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGTAAAGGAGCTGAAGCTTCAGG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 13003
Forward primer (5'-3')
AGCCAGCAGCTGACAATGATGCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGTAAAGGAGCTGAAGCTTCAGG
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 13004
Forward primer (5'-3')
AGCCAGCAGCTGACAATGATGCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGTAAAGGAGCTGAAGCTTCAGG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 32929
Forward primer (5'-3')
AGCCAGCAGCTGACAATGATGCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGTAAAGGAGCTGAAGCTTCAGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 32930
Forward primer (5'-3')
AGCCAGCAGCTGACAATGATGCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGTAAAGGAGCTGAAGCTTCAGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 32931
Forward primer (5'-3')
AGCCAGCAGCTGACAATGATGCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGTAAAGGAGCTGAAGCTTCAGG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 32932
Forward primer (5'-3')
AGCCAGCAGCTGACAATGATGCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGTAAAGGAGCTGAAGCTTCAGG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 10684
Forward primer (5'-3')
AGCCAGCAGCTGACAATGATGCAC
Digested band sizes (using amplicon difference)
Solanum lycopersicum LA925: 900
Solanum pennellii LA716: 950
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGTAAAGGAGCTGAAGCTTCAGG
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
  
Accessions and product sizes
Solanum lycopersicum LA925: 900
Solanum pennellii LA716: 950
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At2g26590  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7313 marker 7313
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)