SGN Marker C2_At2g27290

SGN-M7321
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303851 (SGN)
124494 (CGN)
---
Lycopersicon CombinedSingleSGN-U226504---
Solanum tuberosumMultipleSGN-U254221---
ArabidopsisSingleAt2g27290 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38335)
Chromosome
11
Position
71.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39592
Forward primer (5'-3')
AATTAGAGCATTGAAGGAGAAAAC
Accessions and product sizes
Solanum pennellii TA56
1400
Solanum lycopersicum TA209
1400
Approximate temperature
55°C
Reverse primer (5'-3')
TAGCAAGGATTGAACATCAACACC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
1400
Solanum lycopersicum TA209
450+500
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25738)
Chromosome
2
Position
11.69 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10695
Forward primer (5'-3')
AATTAGAGCATTGAAGGAGAAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGCAAGGATTGAACATCAACACC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 10696
Forward primer (5'-3')
AATTAGAGCATTGAAGGAGAAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGCAAGGATTGAACATCAACACC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 10697
Forward primer (5'-3')
AATTAGAGCATTGAAGGAGAAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGCAAGGATTGAACATCAACACC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 13005
Forward primer (5'-3')
AATTAGAGCATTGAAGGAGAAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGCAAGGATTGAACATCAACACC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13006
Forward primer (5'-3')
AATTAGAGCATTGAAGGAGAAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGCAAGGATTGAACATCAACACC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 10698
Forward primer (5'-3')
AATTAGAGCATTGAAGGAGAAAAC
Digested band sizes (using HinfI)
Solanum pennellii LA716: 1000
Solanum lycopersicum LA925: 850
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGCAAGGATTGAACATCAACACC
Enzymes
All possible enzymes for pennellii and and lycopersicum: RsaI, HinfI
  
Accessions and product sizes
Solanum pennellii LA716: 1100
Solanum lycopersicum LA925: 1100
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At2g27290  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7321 marker 7321
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)