Sol Genomics Network

SGN Marker C2_At2g27450

SGN-M7323
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

Synonyms

None

Locus associations

None

Orthologs in this COSII group

Species	Copies	Sequence ID	CDS/Edited sequence	Peptide sequence	Predicted introns
Lycopersicon Combined	Single	SGN-U217208	-	-	-
Solanum tuberosum	Single	SGN-U249932	-	-	-
Arabidopsis	Single	At2g27450 on TAIR	-	-	-

Mapped locations

Map: Pepper-COSII
Map version 58 (location: 41376)
Chromosome 11
Position 91.90 cM
Confidence F(LOD3)
Protocol dCAPS

Pepper-COSII

PCR data Exp. ID 43352

Forward primer (5'-3')

TCAAGATGATGGACTTGATTCTCG

Accessions and product sizes

Approximate temperature

55°C

Reverse primer (5'-3')

AGAGAAAATGTTACATTTGCTAGTA

Digested band sizes (using unknown enzyme)

Mg⁺² concentration

Unknown

Enzymes

Map: Tomato-EXPEN 2000
Map version 52 (location: 38336)
Chromosome 11
Position 73.00 cM
Confidence I
Protocol CAPS

Tomato-EXPEN 2000

PCR data Exp. ID 39593

Forward primer (5'-3')

TCAAGATGATGGACTTGATTCTCG

Accessions and product sizes

Solanum lycopersicum TA209

500

Solanum pennellii TA56

500

Approximate temperature

55°C

Reverse primer (5'-3')

TCTCAATTATCTCCTTTCCAATGC

Digested band sizes (using amplicon difference)

Solanum lycopersicum TA209

150+250

Solanum pennellii TA56

500

Mg⁺² concentration

1.5mM

Enzymes

Map: Arabidopsis COSII
Map version 44 (location: 25740)
Chromosome 2
Position 11.75 MB
Confidence uncalculated
Protocol CAPS

Arabidopsis COSII

Other PCR data

PCR data Exp. ID 10699
Forward primer (5'-3') TCAAGATGATGGACTTGATTCTCG		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TCTCAATTATCTCCTTTCCAATGC	Enzymes
Accessions and product sizes Solanum pennellii LA716: 550	Approximate temperature 55°C

PCR data Exp. ID 10700
Forward primer (5'-3') TCAAGATGATGGACTTGATTCTCG		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TCTCAATTATCTCCTTTCCAATGC	Enzymes
Accessions and product sizes Solanum lycopersicum LA925: 550	Approximate temperature 55°C

PCR data Exp. ID 10701
Forward primer (5'-3') TCAAGATGATGGACTTGATTCTCG		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TCTCAATTATCTCCTTTCCAATGC	Enzymes
Accessions and product sizes Solanum pimpinellifolium LA1589: 550	Approximate temperature 55°C

PCR data Exp. ID 32245
Forward primer (5'-3') TCAAGATGATGGACTTGATTCTCG	Digested band sizes (using BstNI) Solanum pennellii LA716: 200 Solanum lycopersicum LA925: 150	Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TCTCAATTATCTCCTTTCCAATGC	Enzymes All possible enzymes for pennellii and and lycopersicum: BstNI,ScrFI
Accessions and product sizes Solanum pennellii LA716: 550 Solanum lycopersicum LA925: 550	Approximate temperature 55°C

Unigene blast matches for primers

SGN-U217208
SGN-U273550

Universal primers for Asterid species

No additional PCR data found.

Other COSII sequence data

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Related Markers

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of C2_At2g27450

%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7323 marker 7323

User comments

Please wait, checking for comments. (If comments do not show up, access them here)

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: