SGN Marker C2_At2g28250

SGN-M7332
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle309096 (SGN)
128053 (CGN)
---
Lycopersicon CombinedSingleSGN-U219355---
Solanum tuberosumSingleSGN-U262149---
ArabidopsisSingleAt2g28250 on TAIR---
Mapped locations  
Map: Tobacco N. acuminata   
Map version
89 (location: 46465)
Chromosome
11
Position
56.70 cM
Confidence
I(LOD2)
Protocol
dCAPS


Tobacco N. acuminata

Map: Pepper-COSII   
Map version
58 (location: 41377)
Chromosome
11
Position
110.20 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43353
Forward primer (5'-3')
AGACTTCATCATCGTCATGTGGTTCCG
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
TTTGGAGGTGCTTTGCCATACCAAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38338)
Chromosome
11
Position
82.30 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39595
Forward primer (5'-3')
AGACTTCATCATCGTCATGTGGTTCCG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TTTGGAGGTGCTTTGCCATACCAAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25749)
Chromosome
2
Position
12.05 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At2g28250  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7332 marker 7332
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)