SGN Marker C2_At2g28370

SGN-M7333
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303877 (SGN)
122773 (CGN)
---
Capsicum annuumSingleSGN-U202331---
Lycopersicon CombinedSingleSGN-U220024---
Solanum tuberosumSingleSGN-U258595---
ArabidopsisSingleAt2g28370 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38339)
Chromosome
1
Position
69.10 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39596
Forward primer (5'-3')
ATGTGCCAATTCTTTTGGATTCT
Accessions and product sizes
Solanum pennellii TA56
370
Solanum lycopersicum TA209
370
Approximate temperature
55°C
Reverse primer (5'-3')
CATATGTCGCAAGATATCCCAGTT
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
370
Solanum pennellii TA56
170+200
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25750)
Chromosome
2
Position
12.14 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32246
Forward primer (5'-3')
TGAAGGATGTTCAAGGAATGCCTGG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TGTGAGCAGACACCAAGGTCATTGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 650
Approximate temperature
53°C
  
PCR data   Exp. ID 32247
Forward primer (5'-3')
TGAAGGATGTTCAAGGAATGCCTGG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TGTGAGCAGACACCAAGGTCATTGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 500
Approximate temperature
53°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At2g28370  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7333 marker 7333
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)