SGN Marker C2_At2g28490

SGN-M7339
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeMultiple299274 (SGN)
124957 (CGN)
---
Capsicum annuumSingleSGN-U198676---
Lycopersicon CombinedSingleSGN-U241303---
ArabidopsisSingleAt2g28490 on TAIR---
Mapped locations  
Map: Solanum michoacanum 2011   
Map version
155 (location: 109227)
Chromosome
11
Position
0.00 cM
Confidence
uncalculated
Protocol
CAPS


Solanum michoacanum 2011

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49229)
Chromosome
11
Position
52.65 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47160)
Chromosome
11
Position
118.00 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46634)
Chromosome
11
Position
76.80 cM
Confidence
F(LOD3)
Protocol
PCR


Tobacco N. tomentosiformis

Map: Eggplant-COSII   
Map version
63 (location: 42199)
Chromosome
12
Position
83.50 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43764
Forward primer (5'-3')
ACGGAGTATTCTCCATTGAAACACTCTG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ATTGAATTCTGACCCACCAAGAACTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41378)
Chromosome
11
Position
71.40 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43354
Forward primer (5'-3')
ACGGAGTATTCTCCATTGAAACACTCTG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ATTGAATTCTGACCCACCAAGAACTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38340)
Chromosome
11
Position
98.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39597
Forward primer (5'-3')
ACGGAGTATTCTCCATTGAAACACTCTG
Accessions and product sizes
Solanum pennellii TA56
1000
Solanum lycopersicum TA209
1000
Approximate temperature
53°C
Reverse primer (5'-3')
ATTGAATTCTGACCCACCAAGAACTG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
350+650
Solanum pennellii TA56
1000
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25756)
Chromosome
2
Position
12.19 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32248
Forward primer (5'-3')
ACGGAGTATTCTCCATTGAAACACTCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGAATTCTGACCCACCAAGAACTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 32249
Forward primer (5'-3')
ACGGAGTATTCTCCATTGAAACACTCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGAATTCTGACCCACCAAGAACTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 32250
Forward primer (5'-3')
ACGGAGTATTCTCCATTGAAACACTCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGAATTCTGACCCACCAAGAACTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 32251
Forward primer (5'-3')
ACGGAGTATTCTCCATTGAAACACTCTG
Digested band sizes (using TaqI)
Solanum lycopersicum LA925: 320+400
Solanum pennellii LA716: 360+400
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGAATTCTGACCCACCAAGAACTG
Enzymes
All possible enzymes for pennellii and and lycopersicum: AdeI/DraIII,BanI,BglI,BstBI,HinfI,Hpy188I,NheI,TaqI,TspRI
All possible enzymes for lycopersicum and pimpinellifolium: AseI,BanI,HaeIII,Sau96I
  
Accessions and product sizes
Solanum pennellii LA716: 850
Solanum lycopersicum LA925: 850
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At2g28490  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7339 marker 7339
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)