SGN Marker C2_At2g30100

SGN-M7351
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U205232---
Lycopersicon CombinedSingleSGN-U217155---
Solanum tuberosumMultipleSGN-U246971---
ArabidopsisSingleAt2g30100 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49232)
Chromosome
6
Position
1.31 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47163)
Chromosome
6
Position
1.10 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Pepper-COSII   
Map version
58 (location: 41383)
Chromosome
6
Position
41.20 cM
Confidence
F(LOD3)
Protocol
PCR


Pepper-COSII

PCR data   Exp. ID 43359
Forward primer (5'-3')
CAAACTATTTCAGATTTACACTTAAATG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ACCGTTCAAGTTGGCTCTTCACAACAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38347)
Chromosome
6
Position
3.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39601
Forward primer (5'-3')
ACCTCAAGTCTCTCCTTCAACCACTCAC
Accessions and product sizes
Solanum pennellii TA56
1200
Solanum lycopersicum TA209
1300
Approximate temperature
55°C
Reverse primer (5'-3')
ACCGTTCAAGTTGGCTCTTCACAACAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25768)
Chromosome
2
Position
12.86 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At2g30100  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7351 marker 7351
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)