SGN Marker C2_At2g31440

SGN-M7366
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle308204 (SGN)
128281 (CGN)
---
Solanum tuberosumSingleSGN-U253685---
ArabidopsisSingleAt2g31440 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 25783)
Chromosome
2
Position
13.41 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41259
Forward primer (5'-3')
TGGGGGTTTGGGACATGGTGTG
Accessions and product sizes
Solanum pennellii TA56
200
Solanum lycopersicum TA209
200
Approximate temperature
55°C
Reverse primer (5'-3')
TGCCAGCAATTAAGTGAACAACAGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 10738
Forward primer (5'-3')
TGGGGGTTTGGGACATGGTGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCAGCAATTAAGTGAACAACAGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 10739
Forward primer (5'-3')
TGGGGGTTTGGGACATGGTGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCAGCAATTAAGTGAACAACAGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1000+1200
Approximate temperature
55°C
  
PCR data   Exp. ID 10740
Forward primer (5'-3')
TGGGGGTTTGGGACATGGTGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCAGCAATTAAGTGAACAACAGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1000
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At2g31440  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7366 marker 7366
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)