SGN Marker C2_At2g33740

SGN-M7391
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300188 (SGN)
123737 (CGN)
---
Capsicum annuumSingleSGN-U200997---
Lycopersicon CombinedSingleSGN-U219422---
Solanum tuberosumSingleSGN-U263824---
ArabidopsisSingleAt2g33740 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 25808)
Chromosome
2
Position
14.28 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41267
Forward primer (5'-3')
TGCCCATAGTAGGCGCTTTCTGTG
Accessions and product sizes
Solanum lycopersicum TA209
350
Solanum pennellii TA56
350
Approximate temperature
55°C
Reverse primer (5'-3')
AGGAACAGTGACATAAACAACAATGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 10767
Forward primer (5'-3')
TGCCCATAGTAGGCGCTTTCTGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAACAGTGACATAAACAACAATGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 10768
Forward primer (5'-3')
TGCCCATAGTAGGCGCTTTCTGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAACAGTGACATAAACAACAATGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 10769
Forward primer (5'-3')
TGCCCATAGTAGGCGCTTTCTGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAACAGTGACATAAACAACAATGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 350
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At2g33740  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7391 marker 7391
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)