SGN Marker C2_At2g34860

SGN-M7400
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumMultipleSGN-U199019---
Lycopersicon CombinedSingleSGN-U218373---
Solanum tuberosumSingleSGN-U267724---
ArabidopsisSingleAt2g34860 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41386)
Chromosome
1
Position
105.30 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43362
Forward primer (5'-3')
CTGGAAATCCAATTTCTGAACCAA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
GAGCTTTCCATTTTCCTGTACCAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38359)
Chromosome
1
Position
7.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39612
Forward primer (5'-3')
AGTTGAATATGAAGAAGAGGGTAGGG
Accessions and product sizes
Solanum pennellii TA56
400
Solanum lycopersicum TA209
400
Approximate temperature
53°C
Reverse primer (5'-3')
ACAGCCAGGACTTTCATTTCCATC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25819)
Chromosome
2
Position
14.72 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32266
Forward primer (5'-3')
AGTTGAATATGAAGAAGAGGGTAGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAGCCAGGACTTTCATTTCCATC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 32267
Forward primer (5'-3')
AGTTGAATATGAAGAAGAGGGTAGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAGCCAGGACTTTCATTTCCATC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 32268
Forward primer (5'-3')
AGTTGAATATGAAGAAGAGGGTAGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAGCCAGGACTTTCATTTCCATC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 32269
Forward primer (5'-3')
AGTTGAATATGAAGAAGAGGGTAGGG
Digested band sizes (using XbaI)
Solanum lycopersicum LA925: 650
Solanum pennellii LA716: 800
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAGCCAGGACTTTCATTTCCATC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AvaII,BstUI,EcoO109I,HinfI,Sau96I,XbaI
All possible enzymes for lycopersicum and pimpinellifolium: TaqI
  
Accessions and product sizes
Solanum pennellii LA716: 800
Solanum lycopersicum LA925: 800
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At2g34860  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7400 marker 7400
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)