SGN Marker C2_At2g35610

SGN-M7408
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304883 (SGN)
124405 (CGN)
---
Capsicum annuumSingleSGN-U200626---
Lycopersicon CombinedSingleSGN-U216870---
Solanum tuberosumSingleSGN-U245789---
ArabidopsisSingleAt2g35610 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41387)
Chromosome
1
Position
70.30 cM
Confidence
I
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43363
Forward primer (5'-3')
TATTTCGTCCAGGGTAATTCCTCACC
Accessions and product sizes
Approximate temperature
53°C
Reverse primer (5'-3')
TTCCTTCTGTTCCAGCATATTGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38361)
Chromosome
8
Position
41.70 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39614
Forward primer (5'-3')
AATCTCAAACTTGGTCTTCTCCC
Accessions and product sizes
Solanum lycopersicum TA209
550
Solanum pennellii TA56
550
Approximate temperature
55°C
Reverse primer (5'-3')
TTCCTTCTGTTCCAGCATATTGG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
200
Solanum lycopersicum TA209
150
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25827)
Chromosome
2
Position
14.96 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10789
Forward primer (5'-3')
AATCTCAAACTTGGTCTTCTCCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCTTCTGTTCCAGCATATTGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 10790
Forward primer (5'-3')
AATCTCAAACTTGGTCTTCTCCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCTTCTGTTCCAGCATATTGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 10791
Forward primer (5'-3')
AATCTCAAACTTGGTCTTCTCCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCTTCTGTTCCAGCATATTGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 13031
Forward primer (5'-3')
AATCTCAAACTTGGTCTTCTCCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCTTCTGTTCCAGCATATTGG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 13032
Forward primer (5'-3')
AATCTCAAACTTGGTCTTCTCCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCTTCTGTTCCAGCATATTGG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 13033
Forward primer (5'-3')
AATCTCAAACTTGGTCTTCTCCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCTTCTGTTCCAGCATATTGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 13034
Forward primer (5'-3')
AATCTCAAACTTGGTCTTCTCCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCTTCTGTTCCAGCATATTGG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 13035
Forward primer (5'-3')
AATCTCAAACTTGGTCTTCTCCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCTTCTGTTCCAGCATATTGG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 13036
Forward primer (5'-3')
AATCTCAAACTTGGTCTTCTCCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCTTCTGTTCCAGCATATTGG
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 13037
Forward primer (5'-3')
AATCTCAAACTTGGTCTTCTCCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCTTCTGTTCCAGCATATTGG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 13038
Forward primer (5'-3')
AATCTCAAACTTGGTCTTCTCCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCTTCTGTTCCAGCATATTGG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 13039
Forward primer (5'-3')
AATCTCAAACTTGGTCTTCTCCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCTTCTGTTCCAGCATATTGG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 13040
Forward primer (5'-3')
AATCTCAAACTTGGTCTTCTCCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCTTCTGTTCCAGCATATTGG
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 32622
Forward primer (5'-3')
AATCTCAAACTTGGTCTTCTCCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCTTCTGTTCCAGCATATTGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 32946
Forward primer (5'-3')
AATCTCAAACTTGGTCTTCTCCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCTTCTGTTCCAGCATATTGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 32947
Forward primer (5'-3')
AATCTCAAACTTGGTCTTCTCCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCTTCTGTTCCAGCATATTGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 32948
Forward primer (5'-3')
AATCTCAAACTTGGTCTTCTCCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCTTCTGTTCCAGCATATTGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 32949
Forward primer (5'-3')
AATCTCAAACTTGGTCTTCTCCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCTTCTGTTCCAGCATATTGG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 32950
Forward primer (5'-3')
AATCTCAAACTTGGTCTTCTCCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCTTCTGTTCCAGCATATTGG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 10792
Forward primer (5'-3')
AATCTCAAACTTGGTCTTCTCCC
Digested band sizes (using MspI)
Solanum lycopersicum LA925: 350
Solanum pennellii LA716: 100+200
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCTTCTGTTCCAGCATATTGG
Enzymes
All possible enzymes for pennellii and and lycopersicum: MspI
  
Accessions and product sizes
Solanum pennellii LA716: 350
Solanum lycopersicum LA925: 350
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At2g35610  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7408 marker 7408
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)