SGN Marker C2_At2g37240

SGN-M7428
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304697 (SGN)
124468 (CGN)
---
Capsicum annuumSingleSGN-U202349---
Lycopersicon CombinedMultipleSGN-U218930---
Solanum tuberosumSingleSGN-U254820---
ArabidopsisSingleAt2g37240 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49234)
Chromosome
9
Position
0.81 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47165)
Chromosome
9
Position
1.00 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42201)
Chromosome
9
Position
31.50 cM
Confidence
F(LOD3)
Protocol
dCAPS


Eggplant-COSII

PCR data   Exp. ID 43766
Forward primer (5'-3')
GCAGTGTCTATCATAATGTGCATATCTT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ACAAGTGCGACTCCTGCTGCATCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41388)
Chromosome
9
Position
26.70 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43364
Forward primer (5'-3')
TCCTTTGTCGCATAAGAGCTGATTATC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ACAAGTGCGACTCCTGCTGCATCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38366)
Chromosome
9
Position
1.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39619
Forward primer (5'-3')
TCCTTTGTCGCATAAGAGCTGATTATC
Accessions and product sizes
Solanum pennellii TA56
500
Solanum lycopersicum TA209
500
Approximate temperature
55°C
Reverse primer (5'-3')
ACAAGTGCGACTCCTGCTGCATCC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
360
Solanum pennellii TA56
270
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25848)
Chromosome
2
Position
15.65 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10806
Forward primer (5'-3')
TCCTTTGTCGCATAAGAGCTGATTATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAAGTGCGACTCCTGCTGCATCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 10807
Forward primer (5'-3')
TCCTTTGTCGCATAAGAGCTGATTATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAAGTGCGACTCCTGCTGCATCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 10808
Forward primer (5'-3')
TCCTTTGTCGCATAAGAGCTGATTATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAAGTGCGACTCCTGCTGCATCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 10809
Forward primer (5'-3')
TCCTTTGTCGCATAAGAGCTGATTATC
Digested band sizes (using Hpy188I)
Solanum pennellii LA716: 270
Solanum lycopersicum LA925: 360
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAAGTGCGACTCCTGCTGCATCC
Enzymes
All possible enzymes for pennellii and and lycopersicum: Hpy188I
  
Accessions and product sizes
Solanum pennellii LA716: 500
Solanum lycopersicum LA925: 500
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Amplicon sequence alignment, FASTA
At2g37240F.cds.txt, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text


BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Amplicon sequence alignment, FASTA
At2g37240F.cds.txt, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At2g37240  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7428 marker 7428
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)