SGN Marker C2_At2g37330

SGN-M7429
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle307251 (SGN)
129718 (CGN)
---
Lycopersicon CombinedSingleSGN-U235868---
ArabidopsisSingleAt2g37330 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38367)
Chromosome
10
Position
86.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39620
Forward primer (5'-3')
AACTATCCATTATTGGTTTTGTTCTTC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
ACGTTGTCCAGCAGTATAACCAGCAA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25849)
Chromosome
2
Position
15.68 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At2g37330  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7429 marker 7429
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)