SGN Marker C2_At2g38140

SGN-M7440
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U202803---
Lycopersicon CombinedSingleSGN-U217679---
Solanum tuberosumSingleSGN-U259160---
ArabidopsisSingleAt2g38140 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38372)
Chromosome
5
Position
93.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41282
Forward primer (5'-3')
ATGGCTTCTCTTTCTCCTAATTTATC
Accessions and product sizes
Solanum lycopersicum TA209
500
Solanum pennellii TA56
500
Approximate temperature
55°C
Reverse primer (5'-3')
TTGCCTTTCGCCGTCTTCTTATC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
450
Solanum lycopersicum TA209
375
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25861)
Chromosome
2
Position
15.99 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At2g38140  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7440 marker 7440
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)