SGN Marker C2_At2g38440

SGN-M7444
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302494 (SGN)
123420 (CGN)
---
Lycopersicon CombinedSingleSGN-U230457---
ArabidopsisSingleAt2g38440 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38374)
Chromosome
9
Position
50.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41284
Forward primer (5'-3')
AACGGTTGCAACAAGGCCTAGTATTC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TCGTCATCCTCTTCATCACTTCCAGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25865)
Chromosome
2
Position
16.11 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At2g38440  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7444 marker 7444
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)