SGN Marker C2_At2g38550

SGN-M7445
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U200169---
Lycopersicon CombinedSingleSGN-U216743---
Solanum tuberosumSingleSGN-U246690---
ArabidopsisSingleAt2g38550 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 25866)
Chromosome
2
Position
16.14 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41285
Forward primer (5'-3')
TATTCCGATAAAGCTATGATCATTTTG
Accessions and product sizes
Solanum lycopersicum TA209
575
Solanum pennellii TA56
575
Approximate temperature
55°C
Reverse primer (5'-3')
TCCACTTCTCCATGATCGTAAACTTGAG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
425
Solanum pennellii TA56
525
Mg+2 concentration
1.5mM
   Enzymes
  
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At2g38550  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7445 marker 7445
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)