SGN Marker TG438

SGN-M75

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1800
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG438 image not available
Forward sequence
ATGGAGGCCCTTTAACAAATGTCCCACCTCCGGGAGGAATTGTTAGAGTGGGAGTTGCCTGTCAGCAGTATTTGTCCAACACTTCAGTTG
AGCAATTATTTTTTGTCCTAGATTTTTACACATATTTTGGGAGAGTAAGCGAAAAGATAGCAGTTGCTGGGAGGTTCAATTCGCAGGCGG
AAGTAAGTCATAAAACTTTAGGTCGATCATTAAGCAAAAAGGTTCCCGGAGATGCTGCTGTATGTTTATCAGTAAATGATCTGCACCTAA
GATTTTTGGAATCTTCTGCCGCTGACATTTCAGGAATGCCGTTGGTCCAATTTATAGGCAAAGGGCTGTCCATCAAAGTTACTCATAGAA
CCTTGGGGGGTGCTATAGCCATTTCGTCCAGTTTGCTTTGGGAAGGTGTTGAAGTTGATTGTGCAGACACTCTGAGTAGCTTGCCACGTG
AGGACAGCTCGGTGTGGACTT
Reverse sequence
CAGCTCCTAGTTAGGTTACTTGTCTTAAAAATCTCCATGAAAAGAAAAAAAGTTACAAGTAAGTGAGCAAAAGTGACAATAACTGCAAGG
CCTCAATCCCAATCAAGTTGGGATCGACTATATGAATACTGACCATGTTGCTCCATTTAAACACATCTCAGGCCATTATTAAAACAAGAG
AACAAAGAAACTAGTTATTTGCATAAAGACTAAGGTTAGTGCATATTTATCTGTTTTAAGCTATAAAGATAGATGGAAAAACAGCAAAAC
AATCATTGCAATGTTTCTTGTCTAGACCTTGTTTTAAAGTTACAGTCGGAAAAACCCCATATGCAAGATATAAAGTATTTTCTAACATGA
ATCAAAGTTTATCATTTCCACCAAGGCAAATATATTGCACAATAAGAATAAAGTGCTTACAGTAATCAACTCGAGGGGGTATCTTTTTTT
GCCAGGAGATTTTCCGCTGTCATTTGTTACATGCTTAGAACTGCT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53554)
Chromosome
7
Position
91.63 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53319)
Chromosome
7
Position
13.68 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_7 MQTL_1_Late_blight_7
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50388)
Chromosome
7
Position
63.60 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48322)
Chromosome
7
Position
73.66 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42462)
Chromosome
7
Position
101.70 cM
Confidence
I
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40044)
Chromosome
7
Position
73.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 7969)
Chromosome
7
Position
115.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7968)
Chromosome
7
Position
75.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 7973)
Chromosome
7
Position
12.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG438 was used as an overgo probe on plate 7 [well E12]

Plausible BAC Matches:   P130B18

 Overgo Sequences

A sequence
TGGAGGCCCTTTAACAAATGTCCC
B sequence
AATTCCTCCCGGAGGTGGGACATT
AB sequence
TGGAGGCCCTTTAACAAATGTCCCACCTCC
Marker sequence
ATGGAGGCCCTTTAACAAATGTCCCACCTCCGGGAGGAATTGTTAGAGTG
GGAGTTGCCTGTCAGCAGTATTTGTCCAACACTTCAGTTGAGCAATTATT
TTTTGTCCTAGATTTTTACACATATTTTGGGAGAGTAAGCGAAAAGATAG
CAGTTGCTGGGAGGTTCAATTCGCAGGCGGAAGTAAGTCATAAAACTTTA
GGTCGATCATTAAGCAAAAAGGTTCCCGGAGATGCTGCTGTATGTTTATC
AGTAAATGATCTGCACCTAAGATTTTTGGAATCTTCTGCCGCTGACATTT
CAGGAATGCCGTTGGTCCAATTTATAGGCAAAGGGCTGTCCATCAAAGTT
ACTCATAGAACCTTGGGGGGTGCTATAGCCATTTCGTCCAGTTTGCTTTG
GGAAGGTGTTGAAGTTGATTGTGCAGACACTCTGAGTAGCTTGCCACGTG
AGGACAGCTCGGTGTGGACTT
Genomic location of TG438  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D75 marker 75
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)