SGN Marker C2_At2g43360

SGN-M7503
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle306637 (SGN)
131701 (CGN)
---
Capsicum annuumSingleSGN-U201146---
Lycopersicon CombinedSingleSGN-U217712---
Solanum tuberosumSingleSGN-U249276---
ArabidopsisSingleAt2g43360 on TAIR---
Mapped locations  
Map: Tobacco N. acuminata   
Map version
89 (location: 46474)
Chromosome
6
Position
58.10 cM
Confidence
F(LOD3)
Protocol
PCR


Tobacco N. acuminata

Map: Pepper-COSII   
Map version
58 (location: 41393)
Chromosome
6
Position
110.30 cM
Confidence
F(LOD3)
Protocol
PCR


Pepper-COSII

PCR data   Exp. ID 43369
Forward primer (5'-3')
TCGATCTCCTCTTTCATGGCG
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
TTGAGGACAATACGAACAATCTTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38389)
Chromosome
6
Position
67.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39638
Forward primer (5'-3')
TCGATCTCCTCTTTCATGGCG
Accessions and product sizes
Solanum lycopersicum TA209
350
Solanum pennellii TA56
350
Approximate temperature
55°C
Reverse primer (5'-3')
TTGAGGACAATACGAACAATCTTC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
100+200
Solanum lycopersicum TA209
350
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25927)
Chromosome
2
Position
18.02 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10856
Forward primer (5'-3')
TCGATCTCCTCTTTCATGGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGAGGACAATACGAACAATCTTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 10857
Forward primer (5'-3')
TCGATCTCCTCTTTCATGGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGAGGACAATACGAACAATCTTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 10858
Forward primer (5'-3')
TCGATCTCCTCTTTCATGGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGAGGACAATACGAACAATCTTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 13099
Forward primer (5'-3')
TCGATCTCCTCTTTCATGGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGAGGACAATACGAACAATCTTC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1250
Approximate temperature
55°C
  
PCR data   Exp. ID 13100
Forward primer (5'-3')
TCGATCTCCTCTTTCATGGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGAGGACAATACGAACAATCTTC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 32625
Forward primer (5'-3')
TCGATCTCCTCTTTCATGGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGAGGACAATACGAACAATCTTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1250
Approximate temperature
55°C
  
PCR data   Exp. ID 32973
Forward primer (5'-3')
TCGATCTCCTCTTTCATGGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGAGGACAATACGAACAATCTTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1250
Approximate temperature
55°C
  
PCR data   Exp. ID 32974
Forward primer (5'-3')
TCGATCTCCTCTTTCATGGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGAGGACAATACGAACAATCTTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1250
Approximate temperature
55°C
  
PCR data   Exp. ID 10859
Forward primer (5'-3')
TCGATCTCCTCTTTCATGGCG
Digested band sizes (using amplicon difference)
Solanum pennellii LA716: 1350
Solanum lycopersicum LA925: 1300
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGAGGACAATACGAACAATCTTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
  
Accessions and product sizes
Solanum lycopersicum LA925: 1300
Solanum pennellii LA716: 1350
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120061 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120061 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, plain text
Forward amplicon sequence for S. hirtum 120060 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120060 plant #1, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. hirtum 120062 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #1, plain text
Forward amplicon sequence for S. hirtum 120071 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120071 plant #2, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text


BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120061 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120061 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, plain text
Forward amplicon sequence for S. hirtum 120060 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120060 plant #1, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. hirtum 120062 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #1, plain text
Forward amplicon sequence for S. hirtum 120071 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120071 plant #2, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At2g43360  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7503 marker 7503
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)