SGN Marker C2_At2g45240

SGN-M7526
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle311717 (SGN)
128212 (CGN)
---
Capsicum annuumSingleSGN-U202231---
Solanum tuberosumSingleSGN-U246290---
ArabidopsisSingleAt2g45240 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38393)
Chromosome
1
Position
57.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41310
Forward primer (5'-3')
TCCTCGTGAAGGTGCTGCTTTCTG
Accessions and product sizes
Solanum pennellii TA56
375
Solanum lycopersicum TA209
375
Approximate temperature
55°C
Reverse primer (5'-3')
AACTCCAAGATGCCTTGAAACAATCC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
225
Solanum pennellii TA56
375
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25950)
Chromosome
2
Position
18.66 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At2g45240  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7526 marker 7526
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)