SGN Marker C2_At2g45600

SGN-M7530
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U197096---
Solanum tuberosumSingleSGN-U250176---
ArabidopsisSingleAt2g45600 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46646)
Chromosome
1
Position
49.40 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38394)
Chromosome
1
Position
69.10 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39641
Forward primer (5'-3')
TATAGCAGAATCCACCATGGAAGATG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
ACCTGCATGGTACACGATATTTCCTCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25954)
Chromosome
2
Position
18.80 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At2g45600  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7530 marker 7530
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)