SGN Marker C2_At2g45620

SGN-M7531
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302470 (SGN)
119646 (CGN)
---
Lycopersicon CombinedSingleSGN-U222266---
Solanum tuberosumSingleSGN-U261940---
ArabidopsisSingleAt2g45620 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49237)
Chromosome
1
Position
77.33 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47168)
Chromosome
1
Position
67.00 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42205)
Chromosome
11
Position
104.60 cM
Confidence
F(LOD3)
Protocol
PCR


Eggplant-COSII

PCR data   Exp. ID 43771
Forward primer (5'-3')
AAGGATGTTCAAGGAATGCCTGG
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
CATATGTCGCAAGATATCCCAGTT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41394)
Chromosome
1
Position
75.90 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43370
Forward primer (5'-3')
ATGTGCCAATTCTTTTGGATTCT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CATATGTCGCAAGATATCCCAGTT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38395)
Chromosome
1
Position
69.20 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39642
Forward primer (5'-3')
TATGGATCATGTGCCAATTCTTTTG
Accessions and product sizes
Solanum lycopersicum TA209
1600
Solanum pennellii TA56
1600
Approximate temperature
53°C
Reverse primer (5'-3')
TCGAAGCAGCTTTGTGTTAACAACAG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
850
Solanum lycopersicum TA209
1250
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25955)
Chromosome
2
Position
18.80 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10870
Forward primer (5'-3')
TATGGATCATGTGCCAATTCTTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGAAGCAGCTTTGTGTTAACAACAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 10871
Forward primer (5'-3')
TATGGATCATGTGCCAATTCTTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGAAGCAGCTTTGTGTTAACAACAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 10872
Forward primer (5'-3')
TATGGATCATGTGCCAATTCTTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGAAGCAGCTTTGTGTTAACAACAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 32314
Forward primer (5'-3')
TATGGATCATGTGCCAATTCTTTTG
Digested band sizes (using DraI)
Solanum pennellii LA716: 300+320+850
Solanum lycopersicum LA925: 300+1200
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGAAGCAGCTTTGTGTTAACAACAG
Enzymes
All possible enzymes for pennellii and and lycopersicum: BslI,BstNI,BstUI,BstZ17I,BtgI,DpnII,DraI,Hpy188I,MspI,NcoI,PflMI,RsaI,ScrFI,StyI,TspRI,XcmI
  
Accessions and product sizes
Solanum lycopersicum LA925: 1500
Solanum pennellii LA716: 1500
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At2g45620F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At2g45620  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7531 marker 7531
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)