SGN Marker C2_At2g46340

SGN-M7544
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U202789---
Solanum tuberosumSingleSGN-U267226---
ArabidopsisSingleAt2g46340 on TAIR---
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42206)
Chromosome
4
Position
8.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43772
Forward primer (5'-3')
TGGTCTGTTGATTTTTCTCAAGTGGAAC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGTTATCTGTGGATGCAGAAACCAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41396)
Chromosome
10
Position
58.80 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43372
Forward primer (5'-3')
TGGTCTGTTGATTTTTCTCAAGTGGAAC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGTTATCTGTGGATGCAGAAACCAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38399)
Chromosome
10
Position
27.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39645
Forward primer (5'-3')
TGGTCTGTTGATTTTTCTCAAGTGGAAC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TGTTATCTGTGGATGCAGAAACCAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25968)
Chromosome
2
Position
19.03 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At2g46340  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7544 marker 7544
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)